ID: 1196880742

View in Genome Browser
Species Human (GRCh38)
Location X:120196151-120196173
Sequence TTATCTCAGCCGAGGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196880742_1196880748 9 Left 1196880742 X:120196151-120196173 CCCCATCACCTCGGCTGAGATAA No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880742_1196880750 11 Left 1196880742 X:120196151-120196173 CCCCATCACCTCGGCTGAGATAA No data
Right 1196880750 X:120196185-120196207 AAATAAGAGATCCAGCAGAGGGG No data
1196880742_1196880749 10 Left 1196880742 X:120196151-120196173 CCCCATCACCTCGGCTGAGATAA No data
Right 1196880749 X:120196184-120196206 CAAATAAGAGATCCAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196880742 Original CRISPR TTATCTCAGCCGAGGTGATG GGG (reversed) Intergenic
No off target data available for this crispr