ID: 1196880748

View in Genome Browser
Species Human (GRCh38)
Location X:120196183-120196205
Sequence TCAAATAAGAGATCCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196880745_1196880748 1 Left 1196880745 X:120196159-120196181 CCTCGGCTGAGATAACCTAGTGG No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880738_1196880748 29 Left 1196880738 X:120196131-120196153 CCATCGGTCCTCCTGTTTATCCC No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880739_1196880748 21 Left 1196880739 X:120196139-120196161 CCTCCTGTTTATCCCCATCACCT No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880743_1196880748 8 Left 1196880743 X:120196152-120196174 CCCATCACCTCGGCTGAGATAAC No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880744_1196880748 7 Left 1196880744 X:120196153-120196175 CCATCACCTCGGCTGAGATAACC No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880740_1196880748 18 Left 1196880740 X:120196142-120196164 CCTGTTTATCCCCATCACCTCGG No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data
1196880742_1196880748 9 Left 1196880742 X:120196151-120196173 CCCCATCACCTCGGCTGAGATAA No data
Right 1196880748 X:120196183-120196205 TCAAATAAGAGATCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196880748 Original CRISPR TCAAATAAGAGATCCAGCAG AGG Intergenic
No off target data available for this crispr