ID: 1196888548

View in Genome Browser
Species Human (GRCh38)
Location X:120270533-120270555
Sequence CTAAACCAGCGATACCAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888546_1196888548 -8 Left 1196888546 X:120270518-120270540 CCTCTCCAGTTTACTCTAAACCA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 1196888548 X:120270533-120270555 CTAAACCAGCGATACCAATTAGG 0: 1
1: 0
2: 1
3: 7
4: 63
1196888545_1196888548 -7 Left 1196888545 X:120270517-120270539 CCCTCTCCAGTTTACTCTAAACC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1196888548 X:120270533-120270555 CTAAACCAGCGATACCAATTAGG 0: 1
1: 0
2: 1
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888548 Original CRISPR CTAAACCAGCGATACCAATT AGG Intronic
902103231 1:14011206-14011228 CTAAACCAGAGGTAGCAACTCGG - Intergenic
902355811 1:15899047-15899069 CTGAACCAGCGATTCCACTATGG - Intronic
909122685 1:71624333-71624355 CAAAACCAGGAAGACCAATTAGG - Intronic
918517114 1:185375510-185375532 AGAAGCCAGGGATACCAATTAGG - Intergenic
1064484046 10:15766686-15766708 CTGAACCAGAAAAACCAATTAGG + Intergenic
1067692814 10:48513197-48513219 CTAAAGCTGTGATACCAATTGGG + Intronic
1072069643 10:91903941-91903963 CTAAACCAGCGTGACCAACATGG - Intergenic
1077723719 11:4652574-4652596 CTAAACCAGGGAGGCCTATTAGG - Exonic
1077824388 11:5788750-5788772 CCAAACCAGGGATGCCATTTAGG + Exonic
1077954169 11:6995639-6995661 CCAAAGCAGGGATTCCAATTAGG - Intergenic
1082003422 11:47407220-47407242 CTAACCCAGGGATTCCATTTTGG + Intronic
1087613201 11:100458414-100458436 CTATACCAGAGATATAAATTCGG + Intergenic
1091313411 11:134592714-134592736 CTAAACCAGCATTACCAGGTTGG - Intergenic
1096671829 12:53204177-53204199 CAAAACCAGCCATACCAACATGG + Intronic
1108275860 13:48809028-48809050 CTAAACCAGGGATAGCAATTAGG - Intergenic
1108733485 13:53258542-53258564 TTAAACCAGTGATCCCAACTGGG - Intergenic
1122552143 14:102555901-102555923 CGAGACCAGCCTTACCAATTTGG + Intergenic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1125621407 15:41066176-41066198 CTAAACCAGCCTAACCAATGTGG - Intronic
1126087909 15:45026248-45026270 GTAAACCAGAGATAGCAACTAGG + Intronic
1127534848 15:59880618-59880640 CTAAACCAGGGATGCTAAATTGG + Intergenic
1131498402 15:92935475-92935497 CTAAACCAGGGCCACCAATGAGG - Intronic
1140121131 16:72083823-72083845 TTATACCAGAGATACCATTTGGG + Intronic
1141743454 16:85909870-85909892 CTAAACCAGCGCTGGTAATTAGG - Intronic
1147024376 17:37566958-37566980 GTAAACCAGCAATTACAATTAGG + Intronic
1149250115 17:54758730-54758752 ATAAACCAGAGATAGCAAGTTGG + Intergenic
1154503717 18:15011142-15011164 CTAAACCAGCACAACCATTTTGG + Intergenic
931256389 2:60577568-60577590 CTAAACCAGTCATAAAAATTTGG + Intergenic
938502897 2:131841300-131841322 CTAAACCAGCACAACCATTTTGG + Intergenic
944108246 2:196102641-196102663 CTAAATTAGGGATACCAACTAGG + Intergenic
1169471338 20:5888090-5888112 ATAAACCACCTGTACCAATTAGG - Intergenic
1170041398 20:12043598-12043620 CGAGACCAGCCATACCAATATGG - Intergenic
1172494847 20:35373197-35373219 CTAAACCAGCAAAACCCTTTTGG + Intronic
1183027978 22:35080476-35080498 ATAAACCAGGGACAACAATTTGG - Intronic
949455624 3:4235395-4235417 CTAGACCAGAGATACAGATTTGG + Intronic
958120884 3:89286442-89286464 CGAAAGCAGGGAGACCAATTAGG + Intronic
958429232 3:94018593-94018615 CTAAACTGGAGATACAAATTTGG - Intronic
959287308 3:104431931-104431953 CTAGACCAGTGATTCCAGTTTGG + Intergenic
966227409 3:177612602-177612624 CTAAAACAGAGATGCAAATTGGG + Intergenic
970551808 4:17189167-17189189 CTAGACCAGAGATGCCAAATGGG - Intergenic
973844977 4:54902395-54902417 CTAAACCAGCCAGACCAGTTTGG + Intergenic
978677280 4:111334400-111334422 CTAAACCAGCAATATCTTTTAGG + Intergenic
981602083 4:146501211-146501233 CTAAACTAGAGATATAAATTAGG - Intronic
982362636 4:154537236-154537258 GTAAAACAGCTATACCAATTTGG - Intronic
982862048 4:160464178-160464200 CAAAACCAGAGACACCAATATGG + Intergenic
983645648 4:169988839-169988861 CTAAAGCAGCAAAACCAATCAGG + Exonic
988907517 5:35804411-35804433 CAAAACCAGTGAGGCCAATTTGG - Intronic
993075453 5:83225164-83225186 CAAAAACAGCGATAACAGTTTGG - Intronic
995539891 5:113175021-113175043 CTTAACCAGCATTAACAATTTGG - Intronic
1001526953 5:172435977-172435999 CTAGACCAGGGATGCCAAGTAGG - Intronic
1002633855 5:180597615-180597637 CCAAACCTCCGATACCAATTTGG + Intergenic
1009514211 6:64594047-64594069 CTAAAGCAGGGATGCCTATTAGG - Intronic
1010371319 6:75111513-75111535 CTAAACCACTGATAACCATTTGG - Intronic
1010706077 6:79112409-79112431 CAGAACCAGGGACACCAATTAGG - Intergenic
1010892049 6:81325179-81325201 CAAAACCAGAGATATGAATTTGG - Intergenic
1019860225 7:3651904-3651926 CTAAGCCAACGATCCCAAGTCGG + Intronic
1020232618 7:6331361-6331383 CAAAACCAGCCTTACCAATATGG - Intronic
1025030570 7:55553546-55553568 CGAAACCAATGATACAAATTAGG + Intronic
1028109915 7:86927690-86927712 TTAAACCAGAGATACCAAATGGG + Intronic
1041550268 8:59092430-59092452 GGAAACCAGGAATACCAATTAGG - Intronic
1041998942 8:64098582-64098604 CTGAAGCAGCTATACCGATTTGG + Intergenic
1043138611 8:76559182-76559204 ATAGACCTGCGATACCAATTTGG + Intergenic
1044126280 8:88461513-88461535 TTAACCCAGCAATACCATTTTGG - Intergenic
1044802881 8:95975191-95975213 GTAGACCAGTGATACCCATTTGG + Intergenic
1050937447 9:11415649-11415671 CTAAACCATCCAGACCAATAAGG - Intergenic
1056697056 9:88867742-88867764 TTAAACCAGCCATAGCCATTAGG + Intergenic
1059595004 9:115710519-115710541 TTAAACCAATGATACCCATTTGG - Intergenic
1185752757 X:2627328-2627350 AGAAACCAGTGATACCATTTGGG + Intergenic
1186249514 X:7651017-7651039 CTAAACCAGGGATCTCAATTAGG - Intergenic
1188303089 X:28529512-28529534 CTAATCCAGCAGTACTAATTTGG - Intergenic
1196695195 X:118603881-118603903 AGAAACCAGAGATACCAGTTTGG + Intronic
1196888548 X:120270533-120270555 CTAAACCAGCGATACCAATTAGG + Intronic