ID: 1196888739

View in Genome Browser
Species Human (GRCh38)
Location X:120272180-120272202
Sequence CAGGGCCCTAGGTGCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888739_1196888746 12 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888746 X:120272215-120272237 GTCACCTGGCTTGTTGAGGCAGG No data
1196888739_1196888751 23 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888739_1196888749 15 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888749 X:120272218-120272240 ACCTGGCTTGTTGAGGCAGGGGG No data
1196888739_1196888744 -2 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888744 X:120272201-120272223 TGAGCATTTGCTTAGTCACCTGG No data
1196888739_1196888752 27 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888752 X:120272230-120272252 GAGGCAGGGGGTCCCCAGGCCGG No data
1196888739_1196888748 14 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888748 X:120272217-120272239 CACCTGGCTTGTTGAGGCAGGGG No data
1196888739_1196888747 13 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888747 X:120272216-120272238 TCACCTGGCTTGTTGAGGCAGGG No data
1196888739_1196888745 8 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888745 X:120272211-120272233 CTTAGTCACCTGGCTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888739 Original CRISPR CAGGGCCCTAGGTGCAGACA GGG (reversed) Intronic