ID: 1196888740

View in Genome Browser
Species Human (GRCh38)
Location X:120272181-120272203
Sequence TCAGGGCCCTAGGTGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888740_1196888744 -3 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888744 X:120272201-120272223 TGAGCATTTGCTTAGTCACCTGG No data
1196888740_1196888749 14 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888749 X:120272218-120272240 ACCTGGCTTGTTGAGGCAGGGGG No data
1196888740_1196888747 12 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888747 X:120272216-120272238 TCACCTGGCTTGTTGAGGCAGGG No data
1196888740_1196888748 13 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888748 X:120272217-120272239 CACCTGGCTTGTTGAGGCAGGGG No data
1196888740_1196888746 11 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888746 X:120272215-120272237 GTCACCTGGCTTGTTGAGGCAGG No data
1196888740_1196888745 7 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888745 X:120272211-120272233 CTTAGTCACCTGGCTTGTTGAGG No data
1196888740_1196888751 22 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888740_1196888752 26 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888752 X:120272230-120272252 GAGGCAGGGGGTCCCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888740 Original CRISPR TCAGGGCCCTAGGTGCAGAC AGG (reversed) Intronic