ID: 1196888741

View in Genome Browser
Species Human (GRCh38)
Location X:120272191-120272213
Sequence AAGCAAATGCTCAGGGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888741_1196888747 2 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888747 X:120272216-120272238 TCACCTGGCTTGTTGAGGCAGGG No data
1196888741_1196888752 16 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888752 X:120272230-120272252 GAGGCAGGGGGTCCCCAGGCCGG No data
1196888741_1196888757 29 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888757 X:120272243-120272265 CCCAGGCCGGAATCCATGGAGGG No data
1196888741_1196888746 1 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888746 X:120272215-120272237 GTCACCTGGCTTGTTGAGGCAGG No data
1196888741_1196888748 3 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888748 X:120272217-120272239 CACCTGGCTTGTTGAGGCAGGGG No data
1196888741_1196888745 -3 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888745 X:120272211-120272233 CTTAGTCACCTGGCTTGTTGAGG No data
1196888741_1196888749 4 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888749 X:120272218-120272240 ACCTGGCTTGTTGAGGCAGGGGG No data
1196888741_1196888755 28 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888755 X:120272242-120272264 CCCCAGGCCGGAATCCATGGAGG No data
1196888741_1196888751 12 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888741_1196888753 25 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888753 X:120272239-120272261 GGTCCCCAGGCCGGAATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888741 Original CRISPR AAGCAAATGCTCAGGGCCCT AGG (reversed) Intronic