ID: 1196888742

View in Genome Browser
Species Human (GRCh38)
Location X:120272198-120272220
Sequence GGTGACTAAGCAAATGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888742_1196888753 18 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888753 X:120272239-120272261 GGTCCCCAGGCCGGAATCCATGG No data
1196888742_1196888749 -3 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888749 X:120272218-120272240 ACCTGGCTTGTTGAGGCAGGGGG No data
1196888742_1196888761 29 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888761 X:120272250-120272272 CGGAATCCATGGAGGGCTCTGGG No data
1196888742_1196888748 -4 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888748 X:120272217-120272239 CACCTGGCTTGTTGAGGCAGGGG No data
1196888742_1196888755 21 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888755 X:120272242-120272264 CCCCAGGCCGGAATCCATGGAGG No data
1196888742_1196888752 9 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888752 X:120272230-120272252 GAGGCAGGGGGTCCCCAGGCCGG No data
1196888742_1196888745 -10 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888745 X:120272211-120272233 CTTAGTCACCTGGCTTGTTGAGG No data
1196888742_1196888751 5 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888742_1196888747 -5 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888747 X:120272216-120272238 TCACCTGGCTTGTTGAGGCAGGG No data
1196888742_1196888746 -6 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888746 X:120272215-120272237 GTCACCTGGCTTGTTGAGGCAGG No data
1196888742_1196888757 22 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888757 X:120272243-120272265 CCCAGGCCGGAATCCATGGAGGG No data
1196888742_1196888760 28 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888760 X:120272249-120272271 CCGGAATCCATGGAGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888742 Original CRISPR GGTGACTAAGCAAATGCTCA GGG (reversed) Intronic