ID: 1196888751

View in Genome Browser
Species Human (GRCh38)
Location X:120272226-120272248
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888743_1196888751 4 Left 1196888743 X:120272199-120272221 CCTGAGCATTTGCTTAGTCACCT No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888741_1196888751 12 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888739_1196888751 23 Left 1196888739 X:120272180-120272202 CCCTGTCTGCACCTAGGGCCCTG No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888742_1196888751 5 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data
1196888740_1196888751 22 Left 1196888740 X:120272181-120272203 CCTGTCTGCACCTAGGGCCCTGA No data
Right 1196888751 X:120272226-120272248 TGTTGAGGCAGGGGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type