ID: 1196888757

View in Genome Browser
Species Human (GRCh38)
Location X:120272243-120272265
Sequence CCCAGGCCGGAATCCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888743_1196888757 21 Left 1196888743 X:120272199-120272221 CCTGAGCATTTGCTTAGTCACCT No data
Right 1196888757 X:120272243-120272265 CCCAGGCCGGAATCCATGGAGGG No data
1196888741_1196888757 29 Left 1196888741 X:120272191-120272213 CCTAGGGCCCTGAGCATTTGCTT No data
Right 1196888757 X:120272243-120272265 CCCAGGCCGGAATCCATGGAGGG No data
1196888742_1196888757 22 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888757 X:120272243-120272265 CCCAGGCCGGAATCCATGGAGGG No data
1196888750_1196888757 1 Left 1196888750 X:120272219-120272241 CCTGGCTTGTTGAGGCAGGGGGT No data
Right 1196888757 X:120272243-120272265 CCCAGGCCGGAATCCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888757 Original CRISPR CCCAGGCCGGAATCCATGGA GGG Intronic