ID: 1196888760

View in Genome Browser
Species Human (GRCh38)
Location X:120272249-120272271
Sequence CCGGAATCCATGGAGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196888742_1196888760 28 Left 1196888742 X:120272198-120272220 CCCTGAGCATTTGCTTAGTCACC No data
Right 1196888760 X:120272249-120272271 CCGGAATCCATGGAGGGCTCTGG No data
1196888750_1196888760 7 Left 1196888750 X:120272219-120272241 CCTGGCTTGTTGAGGCAGGGGGT No data
Right 1196888760 X:120272249-120272271 CCGGAATCCATGGAGGGCTCTGG No data
1196888743_1196888760 27 Left 1196888743 X:120272199-120272221 CCTGAGCATTTGCTTAGTCACCT No data
Right 1196888760 X:120272249-120272271 CCGGAATCCATGGAGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196888760 Original CRISPR CCGGAATCCATGGAGGGCTC TGG Intronic