ID: 1196889054

View in Genome Browser
Species Human (GRCh38)
Location X:120274959-120274981
Sequence AGTTGAGGAGATGGGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196889054_1196889058 -10 Left 1196889054 X:120274959-120274981 CCTGAGGTCCCATCTCCTCAACT 0: 1
1: 0
2: 1
3: 55
4: 309
Right 1196889058 X:120274972-120274994 CTCCTCAACTCGCCAAACCTGGG 0: 1
1: 0
2: 1
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196889054 Original CRISPR AGTTGAGGAGATGGGACCTC AGG (reversed) Intronic
900251746 1:1674491-1674513 TGTTGGGTAGCTGGGACCTCAGG - Intronic
900262154 1:1737347-1737369 TGTTGGGTAGCTGGGACCTCAGG - Intronic
901447559 1:9317591-9317613 TCTTGAGTAGCTGGGACCTCAGG + Intronic
901669456 1:10847163-10847185 AGTTGAGGAGATGGAATTTGGGG - Intergenic
902205442 1:14865024-14865046 CATTGAGGAGATGGTACCTGGGG - Intronic
904034700 1:27552281-27552303 TGGTAAGGAGATGAGACCTCAGG - Intronic
904136540 1:28316911-28316933 AGCTGAGTAGCTGGGACCACAGG + Intergenic
904337865 1:29809845-29809867 AGGTGAGGAGGTGGGGGCTCAGG + Intergenic
904462056 1:30686090-30686112 AGGTGAGGAGGTGGGGGCTCAGG - Intergenic
905343763 1:37297418-37297440 CTTTGAGGAGGTGGTACCTCAGG - Intergenic
905923388 1:41733564-41733586 AGAATAGGAGATGGGAGCTCTGG - Intronic
907389537 1:54149105-54149127 TCTTGAGAAGCTGGGACCTCAGG - Intronic
909612993 1:77572758-77572780 TCTTGAGTAGATGGGACTTCAGG + Intronic
909757299 1:79242535-79242557 ATATGAGGAGGTGGGACCTTTGG + Intergenic
911228547 1:95334539-95334561 ATATTAGGAGATGGGGCCTCTGG - Intergenic
912345832 1:108962745-108962767 ACCTGAGTAGATGGGACCACAGG - Intronic
912501320 1:110124145-110124167 ATTTGAGGAGATTGAAACTCAGG + Intergenic
913105444 1:115609917-115609939 AGCTGAGGAAAAGGGACATCTGG - Intergenic
915960041 1:160258659-160258681 AGCTGAGTAGCTGGGACCGCAGG - Intronic
917015854 1:170531043-170531065 AAATGAGGAAATGGGATCTCAGG + Intergenic
918063854 1:181086241-181086263 TGATGAGGAGATAGGACCACAGG - Intergenic
919413103 1:197271416-197271438 AGTTGAGGACATGTGACATGAGG + Intronic
919885072 1:201927628-201927650 AGTTGAGGACATGGGACAAGTGG + Intronic
920012409 1:202878374-202878396 AGCAGAGGAGATGGGAACCCTGG - Intergenic
920014217 1:202893024-202893046 AGTAGAGTAGCTGGGACCACAGG - Intronic
920709920 1:208285504-208285526 ATTTGAGGAGAAGGGACCAGAGG + Intergenic
921984543 1:221298114-221298136 AGTTGAGTAGCTGGGACTACAGG + Intergenic
922823817 1:228503326-228503348 AGGTGAGGAGATGGAGGCTCAGG + Intergenic
924048906 1:240060743-240060765 ACTTGAGTAGCTGGGACCACAGG - Intronic
1063108152 10:3011897-3011919 ATATTAGGAGATGGGACCTGTGG + Intergenic
1066128343 10:32364550-32364572 AGTTGAGGAGATGGAAGCCCAGG - Intronic
1066469852 10:35687912-35687934 CGTTGAGGAGATGGGAAGCCGGG + Intergenic
1067471016 10:46537736-46537758 AGTGGAGGAGGTGGTACCTAGGG + Intergenic
1069133603 10:64736357-64736379 AGTTGAGGAGACTGAAGCTCAGG - Intergenic
1069915256 10:71783202-71783224 AGTTGAGGGGATGTGAGCTAGGG - Intronic
1070956134 10:80464772-80464794 AGCTGAGGAGGCGGGACCTGGGG + Intronic
1072433883 10:95398049-95398071 AGATGAGGAAATGGGGACTCAGG - Intronic
1072780390 10:98247240-98247262 AGTTGAGGAGAGGGAAGGTCGGG + Intergenic
1074387284 10:113026724-113026746 AATTCAGGAGATGGGATTTCAGG - Intronic
1074506936 10:114079490-114079512 AGATGGGGAGCTGGGAGCTCAGG - Intergenic
1075162415 10:120036033-120036055 AGTTGAAGAGATGGTGACTCAGG - Intergenic
1076242861 10:128923049-128923071 TGCTGAAGAGATGGGATCTCAGG - Intergenic
1076396493 10:130142046-130142068 GGTTGAGTAGGTGGGGCCTCAGG - Intronic
1076919493 10:133444385-133444407 AGGTGAGGAGATGGGCCGCCAGG - Intergenic
1080868701 11:36217529-36217551 AGGTGAGGAAATGGGAACACAGG - Intronic
1082010010 11:47443449-47443471 AGGTGCGGAGATGGGAGATCTGG - Intronic
1083404648 11:62448177-62448199 TGATGAGGAGAGGGGACATCAGG + Intronic
1084156065 11:67313132-67313154 AGTTGAGCAGAAGGAACCCCTGG - Intergenic
1084798167 11:71523100-71523122 ATTTGAGGAGCAGGGACATCTGG + Intronic
1088610280 11:111570009-111570031 AGTGGAGGAGGTAGGACATCAGG - Intergenic
1088868234 11:113869472-113869494 ACTTGAGTAGCTGGGACCACAGG - Intronic
1089110506 11:116052225-116052247 AGTTGGGGGACTGGGACCTCAGG + Intergenic
1089121033 11:116135291-116135313 GGCTGAGGAGGTGGGACTTCAGG - Intergenic
1091610522 12:2004120-2004142 AGTTGTGGAGATGGGGTCTCGGG - Intronic
1092172139 12:6380558-6380580 AGTTGAGTAGCTGGGACTACAGG - Intronic
1092650023 12:10624722-10624744 AGTAGAGGAGATGGCCCCTCGGG + Exonic
1092696336 12:11175767-11175789 ATCTCAGGAGATGGGACCTTTGG + Intergenic
1095611446 12:44133272-44133294 AGTTGAGGAGAGGGTATCTCTGG + Intronic
1096972600 12:55679850-55679872 TGATGAGGGGTTGGGACCTCAGG - Intergenic
1098100509 12:67011192-67011214 CGTTTATGAGATGGGAACTCCGG - Intergenic
1099930215 12:89065616-89065638 AGATGAGGAGAAGGGAGATCAGG + Intergenic
1101034367 12:100690418-100690440 AGTTGAGGAAATGGAAGCTTAGG + Intergenic
1103204656 12:119119010-119119032 ACTTTTGGAGATGGGACCTAGGG + Intronic
1103863506 12:124032875-124032897 TCCTGAGGAGCTGGGACCTCAGG + Intronic
1104050320 12:125190164-125190186 AGTTAAGGAGAGGGGAGCCCAGG - Intronic
1106173759 13:27310638-27310660 AGTTGAGGGGTGGGGTCCTCTGG + Intergenic
1106813002 13:33378404-33378426 AGTGGAGGAGATGGGGCTCCAGG - Intergenic
1107505716 13:41031037-41031059 ACTTGAGTAGCTGGGACCCCAGG - Intronic
1107966880 13:45605089-45605111 AGTTGAGGGGGAGGGGCCTCGGG - Intronic
1107968223 13:45616066-45616088 AGATGAAGAGATGGGACATGTGG + Intergenic
1109698330 13:65992137-65992159 AGCCAAGGAGATGGGAGCTCAGG - Intergenic
1110055001 13:70956727-70956749 AGTTGAGGAGATGGGAATTTAGG + Intergenic
1110379736 13:74836506-74836528 TGGTTAGGAGGTGGGACCTCTGG - Intergenic
1110404535 13:75134910-75134932 AATTGAGGAGAATGGACCTAAGG + Intergenic
1110843669 13:80170323-80170345 TGATTAGGAGATGGGACCTTTGG - Intergenic
1111898383 13:94169952-94169974 AGTTGGGCAGGCGGGACCTCTGG + Intronic
1112032800 13:95473014-95473036 TGTTGAGTAGCTGGGACCACAGG - Intronic
1112760569 13:102689758-102689780 AGCTGAGGAAATGGGAACGCAGG - Intronic
1112870509 13:103964925-103964947 AGTTGAAGAAATGAAACCTCAGG + Intergenic
1112950428 13:104988862-104988884 AGGAGAGCAGATGGGACTTCAGG + Intergenic
1112967692 13:105218332-105218354 AGTTGAGGAGATGGAGGCTCCGG - Intergenic
1112994788 13:105560421-105560443 ATGTGAGGAAGTGGGACCTCTGG - Intergenic
1113635333 13:111915271-111915293 AGTGGGAGAGATGGGACCTGGGG + Intergenic
1115206304 14:30909375-30909397 GGCTGAGGAGCTGGGACCACAGG - Intronic
1117974488 14:61283723-61283745 TCTTGAGTAGCTGGGACCTCAGG - Intronic
1118026409 14:61773516-61773538 TGCTGAGTAGATGGGACCACAGG + Intronic
1118219934 14:63846170-63846192 TCCTGAGGAGCTGGGACCTCAGG + Intergenic
1119128628 14:72151617-72151639 AGTTGACGGGATGGCATCTCAGG + Intronic
1121164723 14:91781782-91781804 GCTTGAGGAGATGGCACCTAGGG + Exonic
1121941579 14:98075781-98075803 AGATGAGGAAATGGAAGCTCCGG - Intergenic
1123010696 14:105348252-105348274 CCTTCAGGAGATGGGACCTCTGG + Intronic
1202911165 14_GL000194v1_random:117783-117805 AGTTGAGTAGCTGGGACTACAGG - Intergenic
1124142773 15:27091999-27092021 AGTGGTGGAGCAGGGACCTCTGG - Intronic
1125486366 15:40113908-40113930 GGTTGAGGAGAGGGGAGCTGAGG - Intergenic
1126667544 15:51089015-51089037 AGTTGAGCCCATGGGAACTCTGG - Intronic
1126674100 15:51144407-51144429 ACTTGAGGAGATAGGACCTTGGG - Intergenic
1127373177 15:58359068-58359090 GGTTGAGGAAGTGGCACCTCTGG - Intronic
1128008559 15:64269208-64269230 AGTTGAGGAGGAGTGACCTATGG - Intronic
1128704903 15:69831841-69831863 AGATGAAGAGGTGGGACCTTTGG - Intergenic
1129317590 15:74754758-74754780 AACAGAGGAGATGGGACCTCAGG - Intronic
1131116259 15:89797846-89797868 AGTTGGGAATCTGGGACCTCCGG - Intronic
1131788736 15:95940909-95940931 TGCAGAGGAGATGGGACTTCAGG + Intergenic
1132742380 16:1421313-1421335 AGTGGAAGAGATGAGACCTAAGG + Intergenic
1133369366 16:5236274-5236296 AGTTGAGGAAATGGTCCCTTGGG + Intergenic
1134013190 16:10870350-10870372 AGTTCTGGAGATGGGAGCTTAGG + Intergenic
1134511784 16:14854456-14854478 TGTTGAGTAGCTGGGACCACAGG + Intronic
1134699427 16:16252955-16252977 TGTTGAGTAGCTGGGACCACAGG + Intronic
1134972402 16:18541716-18541738 TGTTGAGTAGCTGGGACCACAGG - Intronic
1135075561 16:19390433-19390455 AGCCAAGGAGATGGGAGCTCAGG - Intergenic
1135466585 16:22691581-22691603 AGTTGGCCAGATGGGAACTCTGG + Intergenic
1136185830 16:28588382-28588404 AAATGAGGAGAGGGGGCCTCAGG - Intronic
1136232833 16:28897369-28897391 AGCTGAGTAGCTGGGACCACAGG - Intronic
1136596959 16:31257491-31257513 TGTTGAGTAGCTGGGACCACAGG + Intergenic
1139406996 16:66727039-66727061 ACTTGAGTAGATGGGACTACAGG + Intronic
1139693966 16:68659444-68659466 AGTAGAGTAGATGGGACTACAGG - Intronic
1141328929 16:83090141-83090163 AGTGGAGAAGCTGGGACCTGGGG - Intronic
1142556295 17:780378-780400 AGTTAAGGAGATGGGATATCAGG - Intronic
1142793111 17:2284217-2284239 TGTTGAGGATATAGGAACTCAGG - Intronic
1145793265 17:27641287-27641309 AGCAGAGGAGAGGTGACCTCAGG - Intronic
1145808066 17:27748842-27748864 AGCAGAGGAGAGGTGACCTCAGG - Intergenic
1146273424 17:31499078-31499100 AGTTGAGTTGCTGGGACCTCTGG + Intronic
1146913076 17:36660477-36660499 AGGTAAGGAGATGGGATCCCTGG - Intergenic
1147038448 17:37699270-37699292 ACCTGAGGAGATGGGAGCTATGG - Intronic
1147772787 17:42879310-42879332 AGATGGGGAGAAGGGACCTGTGG + Intergenic
1148144998 17:45358623-45358645 TTTTGAGTAGATGGGACCACAGG - Intergenic
1150143563 17:62750146-62750168 AGTCGGGGAGAGGGGACTTCGGG - Intronic
1153527284 18:6009224-6009246 AGTCCAGGAGTTGGGGCCTCAGG + Intronic
1156329156 18:36102807-36102829 AGTTGAGTAGCTGGGACTACAGG + Intergenic
1157720024 18:49916472-49916494 AGTTCAGGAGATGGGGCGTATGG + Intronic
1158484983 18:57858124-57858146 AGATTAGGAGATGGGGCCTTTGG + Intergenic
1159432565 18:68373014-68373036 ACTTGAGTAGCTGGGACTTCGGG - Intergenic
1159781785 18:72668255-72668277 AGTCCAGGAGATGGGACCCGGGG + Intergenic
1159870591 18:73756642-73756664 AGGTGGGGAGATGGCATCTCCGG + Intergenic
1160088364 18:75801423-75801445 ACTGGAGGGGATGGAACCTCCGG + Intergenic
1161481673 19:4513813-4513835 TTTTGAGGAGGTGGGGCCTCTGG - Intronic
1161666861 19:5582392-5582414 GGCTGAGGAGAAGGGACCTCGGG + Intergenic
1161961200 19:7524179-7524201 AGATGAGGAGATGGAGGCTCAGG + Intronic
1162357162 19:10193485-10193507 TGTTGAGTAGTTGGGACCACAGG + Intronic
1162549825 19:11352137-11352159 AGTGGAGGAGATGGGGACCCTGG + Intronic
1162606758 19:11714824-11714846 GAATGAGGAGATGGGATCTCTGG - Intergenic
1162873949 19:13607033-13607055 AGGTGAGTAGATGGTACCTGCGG - Intronic
1163800000 19:19358912-19358934 AGTGGAGGAGATGGGGACTCAGG - Intergenic
1163849333 19:19654522-19654544 AGGTGAGGGGCTGGGGCCTCAGG - Exonic
1163986832 19:20961431-20961453 CCTGGAGAAGATGGGACCTCAGG + Intergenic
1165067484 19:33237448-33237470 AAGTGAGGAGATGGGAGCGCTGG - Intergenic
1165310020 19:35024060-35024082 CGTTTTGGAGATGAGACCTCAGG - Intronic
1165343569 19:35228966-35228988 TGTTGAGTAGCTGGGACTTCAGG + Intergenic
1166304836 19:41931832-41931854 AGTTAAGGAGATGGAATCTTGGG - Intergenic
1167991513 19:53365172-53365194 TCCTGAGTAGATGGGACCTCAGG + Intergenic
1168060383 19:53888840-53888862 AGTTGGGGGGATGGGAACTATGG + Intronic
1168124936 19:54277890-54277912 AGGTGTGGAGATGGGACCGGTGG + Exonic
925260794 2:2526755-2526777 AGTGGAGGAGCTGGGAGGTCAGG - Intergenic
926440695 2:12885485-12885507 AGTTGAGGAAATTGAAGCTCAGG + Intergenic
927744465 2:25604528-25604550 TCCTGAGGAGCTGGGACCTCAGG + Intronic
928215457 2:29357621-29357643 GGTGGGGGAGATGGGGCCTCAGG - Intronic
929624819 2:43395878-43395900 AGTTGAGTAGCTGGGACTACAGG + Intronic
930024458 2:47021695-47021717 ATTTGGGGAGCTGGGATCTCTGG + Intronic
930624242 2:53679014-53679036 AGGGGAGGAGTTGGGACCTGAGG - Intronic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
932884752 2:75539443-75539465 AGATGAGGAAATGGGAAGTCAGG - Intronic
935053012 2:99540042-99540064 AGTAGAGTAGCTGGGACCACAGG + Intergenic
935952772 2:108345824-108345846 AGTTGAGGTGAAAGGACCTAAGG - Intergenic
936451884 2:112639999-112640021 AGTTTAGCACATGGGACCTGGGG - Intergenic
936673338 2:114684874-114684896 AATTGAGGAGATGCTACCTAGGG + Intronic
937028890 2:118721737-118721759 AGTTGGGGAGATGTGATGTCCGG + Intergenic
937151069 2:119686035-119686057 AGCTGAGGAAAGGGGATCTCAGG + Intronic
937497267 2:122434197-122434219 AAATGAGGAGATGGGCCATCAGG + Intergenic
939764759 2:146232795-146232817 AGTTGTAGAAATGGGATCTCAGG - Intergenic
940198117 2:151118905-151118927 ACTTGAGTAGCTGGGACCACAGG + Intergenic
940386141 2:153074833-153074855 AGTTGAGGTGATAGGATCGCTGG - Intergenic
941851853 2:170191134-170191156 CGTAGAGGAGATAGGGCCTCAGG + Intronic
942163090 2:173212668-173212690 AGTTGAGTAACTGGGACCACAGG - Intronic
943431401 2:187806919-187806941 TGTTGAGGAGAGGGGACATTGGG - Intergenic
946815799 2:223577536-223577558 TGTTAAGCAGATGGGACATCAGG + Intergenic
947810444 2:233000795-233000817 GGTATTGGAGATGGGACCTCTGG - Intronic
948814404 2:240502545-240502567 GGGTGAGGACATGGGACCTGGGG - Intronic
948966379 2:241383787-241383809 AGTGCAGGACATGGGAGCTCAGG - Intronic
949025381 2:241765304-241765326 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025399 2:241765354-241765376 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025417 2:241765404-241765426 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025435 2:241765454-241765476 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025453 2:241765504-241765526 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025471 2:241765554-241765576 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025489 2:241765604-241765626 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025507 2:241765654-241765676 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025525 2:241765704-241765726 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025543 2:241765754-241765776 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025562 2:241765804-241765826 AGGTGGGGAGATGGGAGCCCCGG + Intronic
949025580 2:241765854-241765876 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025598 2:241765904-241765926 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025616 2:241765954-241765976 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025634 2:241766004-241766026 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025652 2:241766054-241766076 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025668 2:241766104-241766126 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025686 2:241766154-241766176 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025704 2:241766204-241766226 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025722 2:241766254-241766276 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025740 2:241766304-241766326 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025759 2:241766354-241766376 AGGTGGGGAGATGGGAGCCCCGG + Intronic
949025777 2:241766404-241766426 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025795 2:241766454-241766476 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025813 2:241766504-241766526 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025831 2:241766554-241766576 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025849 2:241766604-241766626 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025867 2:241766654-241766676 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025885 2:241766704-241766726 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025903 2:241766754-241766776 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025921 2:241766804-241766826 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025939 2:241766854-241766876 ACTTGGGGAGATGGGAGCCCCGG + Intronic
949025957 2:241766904-241766926 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025975 2:241766954-241766976 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949025993 2:241767004-241767026 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026011 2:241767054-241767076 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026029 2:241767104-241767126 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026047 2:241767154-241767176 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026065 2:241767204-241767226 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026083 2:241767254-241767276 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026101 2:241767304-241767326 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026119 2:241767354-241767376 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026137 2:241767404-241767426 AGTTGGGGAGATGGGAGCCCCGG + Intronic
949026155 2:241767454-241767476 AGTTGGGGAGATGGGAGCCCCGG + Intronic
1169195655 20:3680960-3680982 AGGGGAGGTGATGGGACCCCTGG - Intronic
1169474031 20:5914713-5914735 AGTTGAGTATATTGGACCTTGGG + Intronic
1171284171 20:23924030-23924052 AGATGAGGAGATGGGTCAGCTGG + Intergenic
1171429246 20:25070357-25070379 ATTTGAGGAGATGTGATCTGTGG + Intergenic
1174573378 20:51520039-51520061 AGTTGAGAGGATGGGGCATCAGG - Intronic
1175718004 20:61268272-61268294 AGGAGAGGAGAAGGCACCTCTGG + Intronic
1176132841 20:63503510-63503532 AGGAGAGGAGATGGGACCTTGGG - Intergenic
1176212655 20:63932611-63932633 AGTGGGGCAGATGGGAGCTCTGG - Exonic
1177818449 21:26003783-26003805 AGTTGAGGTGATGGGGAATCAGG - Intronic
1179540873 21:42082651-42082673 AGCTGAGAAGATGGGAGCTCCGG - Intronic
1180639534 22:17287240-17287262 AGATGAGGAGATGAGAGCTGTGG + Intergenic
1180691760 22:17722355-17722377 AGTTGAGTAGATGAGACTACAGG + Intronic
1180955637 22:19740045-19740067 GGGTGAGGGGATGGGGCCTCAGG - Intergenic
1182097121 22:27633489-27633511 AGGTGGGGATGTGGGACCTCTGG - Intergenic
1183673455 22:39286564-39286586 ACTTCAGGAGAGGGGACCTCAGG - Intergenic
1184655458 22:45939700-45939722 TCTTGAGGAGCTGGGACCACAGG - Intronic
1184709537 22:46240440-46240462 AGTCCAGGAGATGGGAGCTGAGG - Exonic
949943288 3:9171173-9171195 AGTGAGGGAGAGGGGACCTCAGG - Intronic
950441564 3:13013900-13013922 AGGTGAGGACATGAGGCCTCAGG + Intronic
951225540 3:20116797-20116819 AGTTGAGGAAATAGAAGCTCAGG + Intronic
951702022 3:25506482-25506504 AGCTGAGTAGCTGGGACCACAGG - Intronic
952274860 3:31867188-31867210 AGTGGAGGAGATGGGAAACCAGG + Intronic
953031790 3:39184526-39184548 AGTTGAGGCTGTGTGACCTCTGG + Exonic
953250708 3:41243984-41244006 AGTTGAGAAAATGGGGGCTCTGG - Intronic
954314107 3:49791854-49791876 AGTTTAAGAGATGGGATCCCAGG + Intronic
954376514 3:50196693-50196715 AGTTGAGGAGAGAGGAGCTGTGG + Intergenic
956178432 3:66496018-66496040 AGCTGGGGAGATGGGACATGAGG + Intronic
960513948 3:118582263-118582285 AGCTGAGTAGCTGGGACCACAGG - Intergenic
960775966 3:121253752-121253774 AGTAGAGTAGCTGGGACCACAGG + Intronic
963062631 3:141237058-141237080 AGATGGGGAGATGGGACCTTGGG + Intronic
964592131 3:158376525-158376547 AGTTGAGGAGATGGAGCTACAGG - Intronic
964690211 3:159441930-159441952 AGCTGAGGAGATAGGACTGCTGG - Intronic
966347217 3:178992870-178992892 AGTTGAGGGGATGGGATTTCAGG + Intergenic
967102366 3:186226329-186226351 AGTTGTGGAGATGGGGCCAGAGG + Intronic
967218545 3:187229957-187229979 GGGTGAGGAGCTGGGAGCTCTGG - Intronic
967574519 3:191075013-191075035 AGTTGAGGAAATGTGAGCTTTGG - Intergenic
968607053 4:1540443-1540465 AGTTGGGGAGCCGGGACCCCCGG - Intergenic
968934669 4:3603777-3603799 CCTGGAGGAGCTGGGACCTCTGG + Intergenic
969856076 4:10000900-10000922 AGTTGAGGAGATTGGATCAAGGG - Intronic
976875804 4:89851750-89851772 AGGTGAGGTGCTGGCACCTCAGG - Intergenic
978353430 4:107844575-107844597 AGTAGAGTAGCTGGGACCACAGG - Intronic
979132759 4:117069020-117069042 ACTTGAGTAGCTGGGACCACAGG - Intergenic
979135459 4:117106023-117106045 AGTTGAGGAGATTAGAATTCAGG - Intergenic
980114542 4:128666605-128666627 ATATTAGGAGATGGGACCTTTGG - Intergenic
981805277 4:148708046-148708068 AGTTGAGTAGCTGGGACTACAGG + Intergenic
981871913 4:149497170-149497192 AGCTGAGGAGGTGGGAGCTGGGG - Intergenic
984805605 4:183748671-183748693 AGCTGAGGAGGTGGGACCTCAGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985244388 4:187965154-187965176 ACTTGAGTAGCTGGGACCACAGG - Intergenic
985322393 4:188729188-188729210 AGCCGAGAAGATGGGAGCTCAGG + Intergenic
986357757 5:6945312-6945334 GGTTGTGGAGATAGGACATCAGG + Intergenic
988345308 5:30029976-30029998 ATATAAGGAGATGGGACCTTTGG + Intergenic
988509283 5:31852407-31852429 AGTAGAGTAGCTGGGACCACAGG + Intronic
988572410 5:32382177-32382199 AGCTGAGGAGCTGGGACCACAGG - Intronic
988960417 5:36365356-36365378 AGTAGAGTAGCTGGGACCACAGG + Intergenic
988961952 5:36379341-36379363 AGTTGAGAAGACAGAACCTCAGG + Intergenic
989026340 5:37072828-37072850 TCTTGAGTAGATGGGACCACAGG - Intergenic
989170837 5:38469327-38469349 AGGTGAGCAGCTGGGACATCGGG - Intergenic
990404239 5:55471996-55472018 ACCTGAGGAGCTGGGACCACAGG - Intronic
992593702 5:78324130-78324152 AGCTGAGTAGCTGGGACCACAGG + Intergenic
992646697 5:78818022-78818044 AGCTGAGTAGCTGGGACCACAGG - Intronic
993459624 5:88167204-88167226 ACTAGAGAAGATGGTACCTCAGG - Intergenic
994179935 5:96753115-96753137 TCTTGAGGAGATGGGACTACAGG + Intronic
995085639 5:108106133-108106155 TGTGGTGGAGATGGTACCTCTGG - Intronic
997202868 5:132023346-132023368 AGGTCAGAAAATGGGACCTCAGG - Intergenic
997899166 5:137748260-137748282 TGTTGAGGAGAGGTGACTTCAGG - Intergenic
998082935 5:139292073-139292095 AGGTGAGTAGCTGGGACCACAGG + Intronic
998684074 5:144504390-144504412 GGTTGAGGAAATGGGATCTATGG - Intergenic
998802758 5:145887218-145887240 TCTTGAGGAGATGGGACCACAGG + Intergenic
999877774 5:155827277-155827299 AGTTCAGGAGTGGGGACATCAGG + Intergenic
1000470314 5:161631812-161631834 ACTTGAGCAGCTGGGACCACAGG + Intronic
1005411208 6:25548815-25548837 AGTTGGTGAGATGGGCACTCAGG - Intronic
1006356586 6:33562613-33562635 TCTTGAGTAGCTGGGACCTCAGG + Intergenic
1006519485 6:34563100-34563122 AGCTCAGGAGCTGGGCCCTCCGG + Intergenic
1006844802 6:37054801-37054823 AGTTGAGGAGAGGAGCCCTGTGG - Intergenic
1006897027 6:37477755-37477777 AGATGAGGTGAGGGGACCGCTGG - Intronic
1006912867 6:37575408-37575430 CGTTCAGGAGAAGGGACATCTGG + Intergenic
1007654730 6:43445313-43445335 TGGTGAGGGGCTGGGACCTCGGG + Exonic
1008947284 6:57112163-57112185 AGTTGAGTAGAAGGGGCTTCTGG + Intronic
1009588280 6:65634990-65635012 ATATGAGGAGATGGCATCTCAGG - Intronic
1011014879 6:82743726-82743748 ACCTCAAGAGATGGGACCTCTGG + Intergenic
1011721044 6:90156940-90156962 AGCTGGGGAGATGAGACCTTTGG + Intronic
1012164186 6:95927607-95927629 AGTTGAATTGTTGGGACCTCTGG - Intergenic
1014790928 6:125670968-125670990 AGTCAAGGAGATGGGAACTTAGG - Intergenic
1015927756 6:138327315-138327337 AGCTGAGTAGCTGGGACCACAGG - Intronic
1016980556 6:149850067-149850089 AGAGGAGGAGATGGGCGCTCAGG + Intronic
1017981595 6:159405261-159405283 TCTTGAGTAGATGGGACCACAGG + Intergenic
1019761827 7:2818637-2818659 ACTTGAGGAGCTGGGACTACAGG - Intronic
1019928826 7:4210174-4210196 GGTTGGGGAGATGGGAGCGCGGG + Intronic
1019945861 7:4328759-4328781 AGTTGAGGACTAGGCACCTCTGG - Intergenic
1020783096 7:12539721-12539743 AGTCAAGGAGATGAGAGCTCAGG + Intergenic
1023358975 7:39396673-39396695 AGTTAAGGAGGTGGGATTTCTGG - Intronic
1024734793 7:52293648-52293670 AGTTGAGGAGATTGAGACTCTGG - Intergenic
1027216689 7:76188368-76188390 TGTGGAAGAGATGGGGCCTCGGG + Intergenic
1027700044 7:81458645-81458667 AGTAGAGTAGCTGGGACCACAGG + Intergenic
1028705826 7:93844779-93844801 TGTTGAGGAGATGGGGGCTGCGG + Intronic
1028835260 7:95367655-95367677 AGTTGAGGAAATTGAAGCTCAGG + Intronic
1029217906 7:98964990-98965012 CGCTGAGGAGCTGGGACCACAGG - Intronic
1029734984 7:102460665-102460687 AGCTGAGGAGATGGGAGTGCAGG - Intronic
1030928132 7:115482825-115482847 TGATGAGGAAATGGGACTTCTGG + Intergenic
1032191860 7:129770215-129770237 ACTTGAGGACCTGTGACCTCAGG + Intergenic
1032399724 7:131616250-131616272 ACCTGAGTAGATGGGACCACAGG + Intergenic
1033670269 7:143485815-143485837 TCTTGAGGAGCTGGGACCACAGG + Intergenic
1036541569 8:9718389-9718411 AGTTTAGGAGAAGTGGCCTCAGG + Intronic
1038011921 8:23482471-23482493 ACTGGAGCAGATGGGAGCTCTGG + Intergenic
1038077295 8:24090843-24090865 AGTTGAGTAGCTGGGACTACAGG - Intergenic
1039067105 8:33618291-33618313 AGTTGAGTAGCTGGGACTACAGG - Intergenic
1040986879 8:53305046-53305068 AGTTGGGGAGATGGGAAAACAGG + Intergenic
1042543515 8:69930639-69930661 AGTTAAGGCCATGGGACCTGGGG + Intergenic
1044987285 8:97766717-97766739 TCTTGAGTAGATGGGACCACAGG + Intergenic
1047212449 8:122850886-122850908 AGGTGAGGATGTGGGGCCTCAGG - Intronic
1047819382 8:128502093-128502115 AGCTGCGGAGAGGGGAGCTCTGG - Intergenic
1048179873 8:132184914-132184936 AGTGGAGAAGAAGGGATCTCAGG + Intronic
1048993014 8:139772377-139772399 AGATGAGGAGATGGGGGCTGGGG + Intronic
1049602266 8:143513379-143513401 AGGAGAGGAGATGGGGACTCTGG - Intronic
1051661635 9:19432506-19432528 AGTTGAGTAGTTGAGACCTTAGG + Intronic
1051670842 9:19508668-19508690 TCTTGAGTAGCTGGGACCTCAGG - Exonic
1052979081 9:34434513-34434535 AGTTCTGGATATGGGACTTCAGG - Intronic
1053023391 9:34710730-34710752 TCTTGAGGAGCTGGGACCACAGG + Intergenic
1053274856 9:36775648-36775670 AGGAGAGGAGATGGGGCCACTGG + Intergenic
1054455497 9:65428201-65428223 CCTGGAGGAGCTGGGACCTCTGG - Intergenic
1054865435 9:69995736-69995758 GTATGAGGAGATGGGACCTTTGG + Intergenic
1055403348 9:75947963-75947985 TCTTGAGGAGCTGGGACCACAGG + Intronic
1057228142 9:93303272-93303294 AGATGCTGAGATGGCACCTCTGG + Intronic
1057410314 9:94811751-94811773 AGCTGAGGAGATGCCGCCTCTGG - Intronic
1060001445 9:119962497-119962519 AGCTGAGAAGATGGTACCTGTGG - Intergenic
1060277379 9:122192352-122192374 AGATGAGGAAATGAGACCTAGGG + Intronic
1060519739 9:124287415-124287437 AGATGAGGAGATGGGGGCTCAGG - Intronic
1060988569 9:127835473-127835495 CGATGAAGAGATGGGCCCTCTGG + Intronic
1061139969 9:128760001-128760023 TGTTGAGTAGCTGGGACCACAGG + Intronic
1061765916 9:132881342-132881364 TCTTGAGTAGCTGGGACCTCAGG - Intronic
1062051745 9:134450899-134450921 ATGTTGGGAGATGGGACCTCTGG - Intergenic
1185881561 X:3745792-3745814 AGGTTAGGAGGTGGGACCTTTGG - Intergenic
1187220669 X:17322897-17322919 AGCTGAGTAGCTGGGACCACAGG + Intergenic
1187220897 X:17324753-17324775 AGCTGAGTAGCTGGGACCACAGG - Intergenic
1189856176 X:45227479-45227501 AGTGTATGAGATGGGACCTCAGG + Intergenic
1191659491 X:63635392-63635414 AGTTGAGGAAAAGGGAGCTCAGG + Exonic
1193201610 X:78697969-78697991 GGTAGACGAGATAGGACCTCAGG + Intergenic
1194806115 X:98330316-98330338 GATTGAGAAGAAGGGACCTCTGG - Intergenic
1195112934 X:101665599-101665621 CCTTCAGCAGATGGGACCTCTGG - Intergenic
1196768454 X:119270788-119270810 AGATGAGGAGATGGGATATTTGG - Intergenic
1196889054 X:120274959-120274981 AGTTGAGGAGATGGGACCTCAGG - Intronic
1196927059 X:120643957-120643979 TATTGAGTAGCTGGGACCTCAGG - Intergenic
1198993373 X:142543415-142543437 AGCTGAGGAGTTGGAAACTCAGG - Intergenic
1200775531 Y:7167041-7167063 AGTTGTGGAGAAGGGACACCTGG + Intergenic