ID: 1196889107

View in Genome Browser
Species Human (GRCh38)
Location X:120275240-120275262
Sequence CAGAGTCTGGGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1931
Summary {0: 1, 1: 1, 2: 21, 3: 279, 4: 1629}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196889100_1196889107 2 Left 1196889100 X:120275215-120275237 CCTACTTGTTAGTGCTTGGGCAT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG 0: 1
1: 1
2: 21
3: 279
4: 1629
1196889099_1196889107 3 Left 1196889099 X:120275214-120275236 CCCTACTTGTTAGTGCTTGGGCA 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG 0: 1
1: 1
2: 21
3: 279
4: 1629
1196889094_1196889107 22 Left 1196889094 X:120275195-120275217 CCACCTTTGTTGATGCTTCCCCT 0: 1
1: 0
2: 1
3: 20
4: 200
Right 1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG 0: 1
1: 1
2: 21
3: 279
4: 1629
1196889095_1196889107 19 Left 1196889095 X:120275198-120275220 CCTTTGTTGATGCTTCCCCTACT 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG 0: 1
1: 1
2: 21
3: 279
4: 1629
1196889098_1196889107 4 Left 1196889098 X:120275213-120275235 CCCCTACTTGTTAGTGCTTGGGC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG 0: 1
1: 1
2: 21
3: 279
4: 1629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196889107 Original CRISPR CAGAGTCTGGGGAGGGAAGC TGG Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900562628 1:3315023-3315045 CAGGGGCTGGGGAGGGAGGGTGG - Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
900696755 1:4016956-4016978 GAGAGTCGGGGGAGGGGAGGAGG + Intergenic
900863626 1:5251546-5251568 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
901228460 1:7628761-7628783 AAGAGACAGGGGAGGGCAGCAGG + Intronic
901439039 1:9266332-9266354 CTGAGACTGGGGAAGTAAGCGGG + Exonic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901875858 1:12166887-12166909 CAGCGTCTGGGGAGGGGCGTGGG + Intergenic
902634881 1:17728697-17728719 CAGAGGCAGGGGATGGAAGTAGG - Intergenic
902779680 1:18696740-18696762 CAGAGGCTGGGGCGGGTAGTGGG + Intronic
902816039 1:18917322-18917344 CACAGTTTGGGGAGAGGAGCAGG + Intronic
902821602 1:18946745-18946767 CAGAGGCAGGGGAGGGAACTGGG - Intronic
903686904 1:25138599-25138621 CAGAGACTGAGGAAGGGAGCTGG + Intergenic
903840186 1:26233633-26233655 CCAAGTTTGGGGAGGGAGGCAGG + Intergenic
904043966 1:27599438-27599460 CGGAGCCTGGGGAGAGAAGCAGG - Intronic
904216132 1:28921417-28921439 CAAAAACTGGGGAGGGAAGGGGG - Intronic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904644400 1:31955075-31955097 CAGAGGCAGGGGAGGCAGGCAGG + Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904823279 1:33258430-33258452 CAGAGTCGGGGGTTGAAAGCTGG + Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905026182 1:34851512-34851534 CAGAGTCTGGGTTGGGAGCCAGG - Intronic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905226584 1:36482892-36482914 CAGAGCTCGGGGAGAGAAGCTGG - Exonic
905365551 1:37449247-37449269 CAGAGGCTGGGGAGGTGCGCGGG - Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905428298 1:37901853-37901875 CAGAGTGGGAGTAGGGAAGCAGG - Intronic
906056699 1:42923826-42923848 CAGAGTCTGTGGTGGGAAGTGGG + Intergenic
906123780 1:43413793-43413815 CAAAGGCTGGGAAGGGTAGCTGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906343104 1:44998012-44998034 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
906482263 1:46206865-46206887 CACAGTCTGGTTAGGGAAGGAGG + Intronic
906660425 1:47577938-47577960 CAGAAGCTGGGGAGGGCAGTGGG - Intergenic
906879008 1:49569217-49569239 CAGAGTCTGGGAAGGGTAGTTGG + Intronic
906955621 1:50371391-50371413 CAAAGTCTGAGGAGGGGAGAAGG - Intergenic
906969397 1:50495257-50495279 CAGAGGCTAGGGAGGGCAGTGGG - Intronic
907014611 1:50999776-50999798 CAGAGGCTGGGAAGGGTAGCGGG + Intergenic
907445024 1:54501963-54501985 CAAAGGCTGGTGAGGGAGGCAGG - Intergenic
907892514 1:58649176-58649198 CAGAGTCTCAGGTGGGAAGAAGG - Intergenic
907906327 1:58785575-58785597 GCGAGGCAGGGGAGGGAAGCGGG - Intergenic
908242964 1:62203387-62203409 CAGAGCCTGGGAAGGGTAGTAGG - Intronic
908308129 1:62846342-62846364 AAGAGGCTGGGGAAGAAAGCAGG - Intronic
908313454 1:62908899-62908921 CAGAGTATGGGTTGGGGAGCAGG - Intergenic
908496824 1:64702689-64702711 CAGATGCTGGGAAGGGTAGCTGG - Intergenic
908565372 1:65350135-65350157 CAGAGTCTAAGAAGGGACGCAGG - Intronic
908578567 1:65488766-65488788 CAGAGGCTGGGAAGGATAGCAGG - Intronic
908788617 1:67758876-67758898 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
909128930 1:71710730-71710752 CAGAGTCTGGGAAGGGGAATTGG + Intronic
909179174 1:72399272-72399294 CAGAGTCTGGGAAGGGTAGTTGG - Intergenic
909208821 1:72796108-72796130 CAGAGTCTGGGAAGGGTAGTAGG - Intergenic
909316715 1:74229664-74229686 CAGAAGCTGGGAAGGGTAGCAGG + Intronic
909334365 1:74454371-74454393 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
909487843 1:76193513-76193535 CAGAGTCTGGGGTGGCAGGGAGG - Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
910183555 1:84510998-84511020 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
910337997 1:86155647-86155669 CGGGGACTGGGGAGGGGAGCAGG - Intronic
910444049 1:87282714-87282736 AAGAGTTGGGGGAGGGGAGCTGG - Intergenic
910547842 1:88439283-88439305 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
910621074 1:89255327-89255349 CAGAGTCTGGGAAGTGTAGTGGG + Intergenic
910819729 1:91333444-91333466 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
910991196 1:93058357-93058379 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
911020334 1:93380160-93380182 CAAAGACTGGGGAGGGTAGTGGG + Intergenic
911154330 1:94623879-94623901 CACAGCCTGGGGCTGGAAGCAGG + Intergenic
911168519 1:94746207-94746229 CAGAGTCTAGGGAAGTAAGCAGG - Intergenic
911313630 1:96328718-96328740 CAGAGGCTGGAGAGGGGAGGGGG + Intergenic
911493198 1:98595055-98595077 CGGAGTCTGGGAAGGGTAGTTGG - Intergenic
911509862 1:98798448-98798470 CAGAGTCTGGGAAGGGAAGAGGG - Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912016905 1:105050174-105050196 CAGAAGCTGGGGAGGGGAGGAGG - Intergenic
912127910 1:106563143-106563165 GAGAGTCTGGGAAGGGTAGTGGG + Intergenic
912231641 1:107799849-107799871 CAGAGTCCAGGAAGGGAAGGAGG - Intronic
912244434 1:107946012-107946034 TTGAGGCTGGGGAGGGCAGCAGG + Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912771499 1:112467963-112467985 CAGAGTCTGGGAAGGGTGGTTGG - Intronic
912960727 1:114193146-114193168 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
913035364 1:114959736-114959758 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
913043021 1:115047366-115047388 CAGAGGCTGGAAAGGGTAGCAGG + Intergenic
913583086 1:120246364-120246386 CAGAATCTATTGAGGGAAGCAGG - Intergenic
913625086 1:120651996-120652018 CAGAATCTATTGAGGGAAGCAGG + Intergenic
914241723 1:145857334-145857356 CAGAGTCCAGGGATGGAGGCGGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914565074 1:148858182-148858204 CAGAATCTATTGAGGGAAGCAGG - Intronic
914607750 1:149272060-149272082 CAGAATCTATTGAGGGAAGCAGG + Intergenic
914895684 1:151670044-151670066 CAGACTCTGGGAAGGGTAGTGGG - Intronic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
915021714 1:152786097-152786119 CTCAGCCTGGGGAGGGAGGCAGG + Intronic
915089695 1:153415832-153415854 CAAAGTCCAGGGAGGGAAGCAGG - Intergenic
915095813 1:153461308-153461330 CAAAGTCCAGGGAGGGAAGCAGG + Intergenic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915179627 1:154047090-154047112 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
915252778 1:154602427-154602449 CGGAGTCCTGGGAGGGAAGGTGG + Exonic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
915580126 1:156808545-156808567 AAGGGTCTGAGGAGGGAGGCTGG + Intronic
915676008 1:157531813-157531835 CAGAGACTGGGGAGGGGAGAGGG + Intronic
915703575 1:157821684-157821706 CAGAGACTGAGGAGGGAATGAGG - Intergenic
915904653 1:159868911-159868933 CAGAGTCTGGTAGGGGAGGCAGG + Intronic
916011866 1:160713384-160713406 CAGAGGCTGGGAAGGGTAGAGGG + Intergenic
916146228 1:161742509-161742531 CAGAGGCTGGGAAGGGTAGCTGG + Intergenic
916325343 1:163551641-163551663 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
917034713 1:170735663-170735685 CACAGGCTGGGGAGGTAGGCAGG + Intronic
917258126 1:173138441-173138463 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
917300051 1:173563851-173563873 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
917509992 1:175661975-175661997 CAGGGGCTGGGGATGAAAGCGGG - Intronic
917740502 1:177957811-177957833 CAGAGGCTGGGAAGGGCAGTAGG - Intronic
918020283 1:180681045-180681067 TAGAGGCTGGGAAGGGAAGAGGG + Intronic
918027749 1:180769421-180769443 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
918248938 1:182684662-182684684 CAGAGTCGGGGGAGGACCGCAGG + Intergenic
918297926 1:183175126-183175148 CAGAGGCTGGGAAGGGTAGCAGG + Intergenic
918457097 1:184732301-184732323 CAGAGGCTGGGAAGGGTAGGTGG + Intronic
918611017 1:186491969-186491991 CAAAGACTGGGAAGGGTAGCAGG - Intergenic
918644821 1:186891456-186891478 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
918663127 1:187114242-187114264 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
918673939 1:187258117-187258139 CAGAGTCTGGGAAGGCTAGTGGG - Intergenic
918789938 1:188813088-188813110 GAGAGGCACGGGAGGGAAGCAGG + Intergenic
918928572 1:190821578-190821600 CAGAGGCTGGGAAGGTTAGCTGG + Intergenic
919034501 1:192289276-192289298 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919265323 1:195256011-195256033 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
919348408 1:196416923-196416945 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
919477665 1:198049153-198049175 CAGATTCTAGGGAGGGTAGTGGG - Intergenic
919582505 1:199394031-199394053 CAAAGGCTGGGAAGGGTAGCGGG - Intergenic
919598885 1:199598983-199599005 CAGAGGCTGGGAAGGGAACAGGG + Intergenic
919636608 1:200009486-200009508 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
919949798 1:202352473-202352495 CTGAGTGTGGTGAGGGATGCTGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
920572013 1:207024571-207024593 CAGAGGCGGGGGAGGGAGTCAGG - Intronic
920616309 1:207496142-207496164 CAGAGTGTGGGGAGGGCTGCGGG - Intronic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
920739736 1:208569150-208569172 CAGAGGCTGGTGAGGGAGGTGGG + Intergenic
920874934 1:209826101-209826123 CTGCCTCTGGGGAGGGAAACTGG + Intergenic
920967138 1:210710760-210710782 CAGAGTCTGTGCAGAGCAGCGGG - Intronic
921051343 1:211514097-211514119 CAGAGTCTGGGGTTGGGAGTTGG + Intergenic
921237276 1:213146030-213146052 CAGAGTCTGGGAAGGGTAGTGGG - Intronic
921305105 1:213788533-213788555 CAGGGTATGGGGAGGGAGTCAGG - Intergenic
921411156 1:214837558-214837580 CAGAAACATGGGAGGGAAGCAGG + Intergenic
921518527 1:216128908-216128930 CAGAGCCTGGGGAAGGAAATGGG - Intronic
921634925 1:217480998-217481020 CAGAGACTGGGAAGGGGAGTGGG + Intronic
921958378 1:221008108-221008130 CAGAGGTTGGGAAGGGTAGCAGG - Intergenic
922180034 1:223226345-223226367 CTGGGCCTGGGGAGGGATGCAGG + Intronic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922299732 1:224287254-224287276 CAGAGGCTGGGAAGGGAAGGTGG + Intronic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922392591 1:225161168-225161190 CAGAGGCTGGGCAGGGTAGTGGG - Intronic
922406704 1:225321820-225321842 CAGAGTCAGGGGAGGAAGGGTGG - Intronic
922407494 1:225330648-225330670 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
922523760 1:226281260-226281282 CAGAGGCTGGGAAGGGAAAAGGG + Intronic
922549824 1:226485843-226485865 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
922562783 1:226581088-226581110 CAAAGTCTGGGGAAAGCAGCTGG + Intronic
922719511 1:227893142-227893164 TGGGGTCTGGGGAGGGAAGAGGG + Intergenic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
922859515 1:228804185-228804207 CAGAAGCTGGGAAGGGAAGAAGG - Intergenic
922907757 1:229187734-229187756 CAGAGGCTGGGAAGAGAAGGGGG - Intergenic
923130474 1:231070509-231070531 CAGAGGCTGGGAAGGGTAGGTGG + Intergenic
923138717 1:231141961-231141983 TAGAGGCTGGGGAGGGTCGCAGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923304001 1:232671477-232671499 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
923356829 1:233164865-233164887 TAGAGGCTGGGGAGGGGAGAAGG + Intronic
923824269 1:237482352-237482374 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
924009049 1:239644343-239644365 CAGAGCCAGGGGTGGGAAGACGG - Intronic
924141374 1:241027261-241027283 CAGGGAGTGGGGAGGGAAACTGG + Intronic
924236114 1:242000846-242000868 CAGCCTCTGGGGAGGGTAGAGGG - Intergenic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
924473146 1:244361083-244361105 CAGAGGCTGGGAAGGGGAGTGGG + Intronic
924558223 1:245135291-245135313 CAGAGGCTGGGAAGGGGAGTAGG - Intergenic
924599365 1:245474788-245474810 CAGAGGCTGGGATGGGCAGCGGG - Intronic
1062764915 10:54187-54209 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1063545956 10:6981748-6981770 CATAGGCTGGGAAGAGAAGCAGG + Intergenic
1063613484 10:7582830-7582852 CAGAGGCTGGGCAGGGTAGTGGG + Intronic
1063959766 10:11297490-11297512 CAGTGTCAGGGGAGCCAAGCAGG + Intronic
1064356553 10:14624102-14624124 GAGAGGCAGGTGAGGGAAGCTGG + Intronic
1064461624 10:15540293-15540315 CAGAGGCTGGGAAGGGAAGGTGG - Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064483148 10:15759575-15759597 GAGAGTCTGTTGAGGGAAGCAGG + Intergenic
1064597134 10:16957192-16957214 CAGAGGCTGGGGACGGTAGCAGG - Intronic
1064699275 10:18001988-18002010 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1064987255 10:21223197-21223219 CAGAGGCTGGGAAGAGTAGCAGG - Intergenic
1065069988 10:22013708-22013730 CAGAGCCTGGGAAGGGTAGTGGG - Intergenic
1065178828 10:23104840-23104862 GAGAGTGTGGGGAGGGATGACGG - Intronic
1065257026 10:23880440-23880462 CAGAGACTGGGAAGGGTAGTTGG + Intronic
1065426455 10:25609463-25609485 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1065764851 10:29019010-29019032 CAGAGGCTGGGGAGGGTAGTGGG + Intergenic
1065897285 10:30175134-30175156 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1065981038 10:30897553-30897575 CAGAGCCTGGGGAGTGGAGGTGG - Intronic
1066649547 10:37641554-37641576 TAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1066685184 10:37975096-37975118 CAGAGGCTGCGAAGGGAAGTAGG + Intronic
1067020088 10:42788637-42788659 AAGAGGCTGGGAAGGGGAGCAGG - Intronic
1067032437 10:42887100-42887122 CAGAGTCTGGGAAGGGTAGTAGG - Intergenic
1067139918 10:43648507-43648529 CAGCGTCTGCGGAGAGGAGCAGG - Intronic
1067175518 10:43943290-43943312 CTGAGTCTGGGTTGGGAGGCGGG + Intergenic
1067283773 10:44892639-44892661 CAGAGACTGTGGAAGGTAGCAGG - Intergenic
1067370888 10:45680599-45680621 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067388889 10:45845546-45845568 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067417173 10:46111402-46111424 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067445372 10:46339004-46339026 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067499762 10:46792717-46792739 AAGAGGCTGGGAAGGGGAGCAGG - Intergenic
1067502588 10:46818296-46818318 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067592001 10:47521727-47521749 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067594869 10:47547609-47547631 AAGAGGCTGGGAAGGGGAGCAGG + Intronic
1067639118 10:48029798-48029820 CAGAGGCAGGGGATGGGAGCCGG - Intergenic
1067641977 10:48055706-48055728 AAGAGGCTGGGAAGGGGAGCAGG + Intergenic
1067685973 10:48466264-48466286 TAGAGTCTGGGGGGGGGCGCAGG - Intronic
1067734669 10:48840260-48840282 CAGAGTCTGGTGATGGAGGTGGG + Intronic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1067874365 10:49990497-49990519 CAGAGGCAGGGGATGGGAGCCGG + Intronic
1068032291 10:51718765-51718787 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
1068168350 10:53360091-53360113 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1068542432 10:58310336-58310358 CAGAGGCTAGGAAGGGAAGTGGG + Intergenic
1068607094 10:59017666-59017688 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1069397297 10:68003514-68003536 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1069709192 10:70478369-70478391 CAGAGGGGGGCGAGGGAAGCCGG + Intergenic
1069750888 10:70744276-70744298 CACAGTCTGGGGTGGGGAGAAGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069862419 10:71480005-71480027 CAGAGTCATGGGACTGAAGCAGG - Intronic
1069943895 10:71973119-71973141 TCGAGTCTGGGGAGGGTGGCAGG + Intronic
1070058787 10:72960898-72960920 CAGAATCTGGGAAGGGTAGTGGG - Intergenic
1070136108 10:73695955-73695977 CAGAGGCAGGGGATGGGAGCTGG - Intronic
1070139164 10:73724219-73724241 AAGAGACTGGGAAGGGGAGCAGG + Intergenic
1070151360 10:73807190-73807212 CAGAGCCTGGGAAGAGTAGCAGG + Exonic
1070349976 10:75582508-75582530 CTGAGGCTGGGCAGGGTAGCAGG + Intronic
1070354880 10:75630310-75630332 CAAAGAGTGGAGAGGGAAGCGGG - Intronic
1070970753 10:80565318-80565340 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1071113347 10:82188769-82188791 CAGAGGCTGGGAAGGGTAGCGGG + Intronic
1071113370 10:82189112-82189134 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1071451946 10:85803067-85803089 CAGAGGCTGGGAAGGGTAGTTGG + Intronic
1071524575 10:86350946-86350968 TAGAGACTGGGGAGGGCAGGGGG - Intronic
1071606523 10:86996703-86996725 AAGAGGCTGGGAAGGGGAGCAGG - Intergenic
1071932695 10:90490818-90490840 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
1071956036 10:90760330-90760352 CAGAGGCTGGGAAGGGTAGGAGG + Intronic
1071970223 10:90898078-90898100 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1072502210 10:96028964-96028986 CAGAGGCTGGGAAGGGGAGTGGG + Intronic
1072927361 10:99627882-99627904 CAGAGGCTGGGAAGGGTGGCGGG - Intergenic
1073368716 10:102967432-102967454 CAGAGGCTGGAGATGAAAGCAGG - Intronic
1073381248 10:103079525-103079547 CTGAGTCTGGGGAGAGGAGAGGG + Exonic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1073465460 10:103692481-103692503 CAGAGTTGGGGCAGGGAAGAAGG + Intronic
1073998885 10:109347155-109347177 CAGAGTCTGGAAAGGGTAGTGGG - Intergenic
1074017914 10:109553369-109553391 CAGAGGCTGGAAAGGGTAGCGGG - Intergenic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074375177 10:112934626-112934648 CAGAGTCTGGCTAGGGAGGTGGG - Intergenic
1074401753 10:113147249-113147271 CAGGGACTGGGGAAAGAAGCTGG - Intronic
1074425177 10:113344410-113344432 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1074507755 10:114086597-114086619 CTGACCCAGGGGAGGGAAGCTGG - Intergenic
1074518769 10:114198048-114198070 CAGAGGCTGAGTAGGGAACCTGG - Intronic
1074533248 10:114311131-114311153 GAGACTCTGGGAAGGGAGGCTGG + Intronic
1074544825 10:114394331-114394353 CAGAGTCAGGGTGGGGAAACTGG - Intronic
1074794851 10:116932468-116932490 CATGGACTGGGGAGGGAAGAGGG - Intronic
1074897693 10:117791374-117791396 CAGAAGTTGGGGAGGGAAACAGG - Intergenic
1075111257 10:119586699-119586721 TAGAGTCTGGTGAGGGATGGAGG - Intronic
1075919843 10:126201492-126201514 CAGAGCCTTGGGAGGGAACGTGG + Intronic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076840717 10:133043903-133043925 GGGAGGCAGGGGAGGGAAGCAGG - Intergenic
1077041680 11:527420-527442 CAGGGGCTGGGGAGGGGAGCTGG - Intergenic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077428843 11:2504317-2504339 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1077484677 11:2833292-2833314 CAGAGTCAGGGCAGCCAAGCCGG + Intronic
1077726826 11:4683124-4683146 GAAAGTGGGGGGAGGGAAGCAGG - Intronic
1077741083 11:4846392-4846414 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1077877340 11:6319666-6319688 CAGAGTCTGGGGGGAAAGGCAGG + Intronic
1077928211 11:6703735-6703757 CATACACTGGGGAGAGAAGCAGG + Intergenic
1077976287 11:7251933-7251955 CGGTGTCTGGGGAGGGACGGAGG + Exonic
1078750709 11:14159877-14159899 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1079010490 11:16824097-16824119 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1079129035 11:17736996-17737018 TTCAGTGTGGGGAGGGAAGCTGG + Intronic
1079166555 11:18049492-18049514 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1079186134 11:18238816-18238838 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1079246124 11:18753539-18753561 TAGAGTCTGGGGAGGTAAGCAGG - Intronic
1079611033 11:22432746-22432768 CAGGGTCTGCGGCGGGAGGCGGG + Intergenic
1079625362 11:22610770-22610792 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1079772838 11:24485319-24485341 CAGAGACTGGGTAGGGTAGTGGG - Intergenic
1079813766 11:25029072-25029094 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1080097246 11:28423695-28423717 CATAGGCTGGGAAGGGTAGCAGG + Intergenic
1080316121 11:30950694-30950716 CAGAGCCTGGGAAAGGTAGCGGG + Intronic
1081337429 11:41883942-41883964 CAGAGTCTGGGAAGGGTAGTGGG + Intergenic
1081486550 11:43534638-43534660 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
1081945379 11:46988555-46988577 CAGAGATTGGGAAGGGTAGCAGG + Intronic
1082068234 11:47918025-47918047 AAGGGTCTGGGGCGGGTAGCAGG - Intergenic
1082219047 11:49610363-49610385 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1082636449 11:55599982-55600004 CAGCATCAGGGGAGTGAAGCTGG + Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1082879586 11:58024857-58024879 CAGAGTCAGGGCAGGGAGCCAGG + Intronic
1083046879 11:59744623-59744645 CAGAGACTGAGAATGGAAGCAGG + Intronic
1083077234 11:60053697-60053719 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1083177939 11:60964426-60964448 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1083261876 11:61527587-61527609 CAGAGGCCGAGGAGGGAAGCTGG - Intronic
1083303123 11:61749088-61749110 CAGAGGCTGGGGCAGGAAGGTGG - Intergenic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1083367067 11:62147788-62147810 CAGAGTCTGGGAAGGCGAGAAGG + Intronic
1083387121 11:62319554-62319576 AAGAGGCTGGGGAGGGTAGTAGG - Intergenic
1083492971 11:63026776-63026798 CAGGGTCTGGGAAGGGAGGAGGG + Intergenic
1083514069 11:63239728-63239750 CAGAGTCAGGGTAGTGAAGGAGG + Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083857698 11:65401304-65401326 GGGAGGCTGGGGAGGGAGGCTGG - Intronic
1083857704 11:65401317-65401339 GGGAGGCTGGGGAGGGAGGCTGG - Intronic
1083857728 11:65401369-65401391 GGGAGGCTGGGGAGGGAAGCAGG - Intronic
1084173600 11:67412121-67412143 CAGTGTGTGGGGACTGAAGCTGG + Intronic
1084412740 11:69013720-69013742 CCGAGTCCGGGGTGGGAAGGGGG - Intergenic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1084493513 11:69490835-69490857 CAGAGTCTGGAAAGGGAGGTGGG - Intergenic
1084888586 11:72225313-72225335 CTGGGTCTGAGGAGGGACGCAGG + Intronic
1084923925 11:72496271-72496293 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
1085106957 11:73853087-73853109 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
1085466166 11:76724849-76724871 CAGAGACTGGGAATGGAAGTGGG - Intergenic
1085740906 11:79077700-79077722 CAGACTCTGGGGAGGGAAAGAGG + Intronic
1086007417 11:82053992-82054014 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086129734 11:83388815-83388837 CAGAGACTGGGGAGAGTAGGAGG + Intergenic
1086630604 11:89014511-89014533 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1086871455 11:92042294-92042316 CCGAGTCTGGGGAGGGTAGAGGG - Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1086962607 11:92994763-92994785 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087358639 11:97128629-97128651 CAGAGGCTGGGGAGGGGTGCAGG - Intergenic
1087733005 11:101799642-101799664 CAGAGGCTGGGAAAGGAAGAGGG + Intronic
1087888925 11:103514311-103514333 CAGAGGCTGGGGAGGGTAAAGGG + Intergenic
1087890910 11:103537093-103537115 CAGAGTCTTGTGAGGGGCGCAGG - Intergenic
1087952497 11:104240206-104240228 CAGAGCCTGAGGAGAGAAGACGG - Intergenic
1088361490 11:108994645-108994667 CAGAGGCTGGGCAGGGTAGTGGG - Intergenic
1088370872 11:109087230-109087252 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
1088586254 11:111362461-111362483 CAGAAGCTGGGAAGGGCAGCAGG - Intronic
1088694463 11:112355033-112355055 GAGAGTCAGGGGAGAGAGGCTGG + Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088821262 11:113459627-113459649 CAGAGGCTGGGAAGGGGAGGGGG + Intronic
1088904415 11:114143410-114143432 CAGAGGCTGGGGGGGAAAGGGGG + Intronic
1089066382 11:115665261-115665283 CAGAGGCTGGGAAGGGCAGCGGG + Intergenic
1089171308 11:116513556-116513578 AAGAGTCTGGAGAGGGAGACAGG - Intergenic
1089286908 11:117413159-117413181 CAGAGCCTGCTGATGGAAGCGGG - Exonic
1089347655 11:117801121-117801143 TAAATTTTGGGGAGGGAAGCAGG - Intronic
1089591669 11:119546047-119546069 CAGGGTCTGGGGAGGAAAGTAGG + Intergenic
1089604825 11:119635752-119635774 CAGAGCCCGGGGAGGGAAGGCGG + Intronic
1089717540 11:120376795-120376817 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1089907084 11:122051227-122051249 CAGAGGCTGGGAAAGGTAGCGGG - Intergenic
1090391876 11:126394168-126394190 CAGTGTCTGGGGCTGGAATCTGG - Intronic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1091337913 11:134786280-134786302 CAGGGTAGGGGGTGGGAAGCAGG - Intergenic
1091524443 12:1284059-1284081 CAGAGGCTGGGAAGGGTAGGAGG - Intronic
1091867093 12:3849639-3849661 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
1091925788 12:4347390-4347412 CAGAGTCTGGGAAAGGTAGTAGG + Intronic
1092125472 12:6072269-6072291 GGGGGACTGGGGAGGGAAGCTGG - Intronic
1092700977 12:11230532-11230554 TAGAGGCTGGGAAGGGAAGGGGG - Intergenic
1092894685 12:13000572-13000594 GGGTGTCTGGGGAGGGAACCCGG + Intergenic
1093258997 12:16911212-16911234 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1093419447 12:18957975-18957997 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1093678220 12:21968814-21968836 CAGAGGTTGGGAAGGGCAGCTGG + Intergenic
1093710886 12:22328697-22328719 CACAGCCTGGGAAGGGAAGAAGG + Intronic
1093902414 12:24651058-24651080 CAGAGGTTGGGAAGGGAAGTGGG - Intergenic
1093984514 12:25514497-25514519 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1093992086 12:25601291-25601313 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1094039794 12:26110658-26110680 GAGAGTTTGGGGAGGGGAGGGGG + Intergenic
1094061873 12:26322901-26322923 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1094330797 12:29290844-29290866 CAGAGGCTGGGAAGGCAAGTGGG + Intronic
1094365098 12:29671872-29671894 AAGAGTCTGGGTAGGCAAGAGGG + Intronic
1094514985 12:31120840-31120862 AAGAGCCTGGGGGGGGAAGAGGG - Intergenic
1094655390 12:32414579-32414601 CAGAGGCTGGGAAGTGCAGCTGG - Intronic
1094810414 12:34131782-34131804 CAGAGGCTGGGGAGGATAGTGGG + Intergenic
1094815123 12:34175662-34175684 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1095134282 12:38579669-38579691 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1095271771 12:40226883-40226905 CAGAGTCTAGGGAATGAAGGTGG - Intronic
1095572325 12:43697430-43697452 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1095819360 12:46460375-46460397 CAGAGTTTGGGAAGTGAATCTGG + Intergenic
1096098945 12:48957285-48957307 GAGAGGCTGGGAAGGGAAGGCGG - Intronic
1096233898 12:49912913-49912935 CACAGTCTAGAGGGGGAAGCAGG + Intergenic
1096447883 12:51710552-51710574 CGGAGTCTGAGGCGGGAAGATGG + Intronic
1096474090 12:51897335-51897357 CAGAGCCTGGGCACGGATGCTGG + Intergenic
1096499420 12:52055976-52055998 CAGAGTGTGGGGTGGGGAGGGGG - Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096685125 12:53283258-53283280 GTGAGTCTGGGGAGGACAGCAGG + Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097087659 12:56480399-56480421 CAGAGAATGGGGAGGAAAGTGGG + Intronic
1097187040 12:57201641-57201663 CAGACACTGGGGAGGGAAGCTGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097240137 12:57569440-57569462 CAGAGGCTGGGATGGGAAGCTGG - Intronic
1097371354 12:58785468-58785490 CAAAATCTGGGGAGGCAAGGGGG - Intronic
1097608439 12:61785114-61785136 TAGAGTCTGGGAAGGGCAGGAGG - Intronic
1097714186 12:62948137-62948159 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1097815739 12:64071627-64071649 CAGAGTCAGGGGTGGGCCGCAGG + Intronic
1098142479 12:67464416-67464438 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1098207334 12:68125734-68125756 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1098240143 12:68458663-68458685 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1098392649 12:69985846-69985868 CAGAGTCTGGGCAAGGGAGAGGG - Intergenic
1099330758 12:81283016-81283038 AAGAATCTGAGGAAGGAAGCTGG - Exonic
1099491669 12:83295473-83295495 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100039441 12:90295934-90295956 CAGAGGCTGGGAATGGAAGCTGG - Intergenic
1100060482 12:90569167-90569189 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1100281849 12:93125820-93125842 CAGAGGCTGGGAAGCGTAGCAGG + Intergenic
1100480629 12:94974838-94974860 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1100679066 12:96899042-96899064 CAGAGGCTGGGGAGTGATGGTGG - Intergenic
1100908872 12:99335499-99335521 TAGAGGCTGGGAAGGGTAGCTGG - Intronic
1100910845 12:99360948-99360970 CAGAGGCTGGGAAGGGTAGCTGG + Intronic
1100945903 12:99783714-99783736 GAGAGGCTGGGCAGGGGAGCAGG + Intronic
1100946871 12:99794685-99794707 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1100958119 12:99931918-99931940 CAGAGGCTGGGAAGGGGAGTAGG - Intronic
1101239828 12:102826946-102826968 CAAATACTGGGGAGGGAAGAGGG - Intergenic
1101904817 12:108816670-108816692 CAGAGTCTGCCAAGGGAAGCAGG - Intronic
1101954900 12:109204646-109204668 CAGGGTCTGGGAAGGGTAGTGGG - Intronic
1102013396 12:109632644-109632666 CACAGTCTGGAAGGGGAAGCAGG - Intergenic
1102190623 12:110985174-110985196 CAGAGACTGGGGTTGCAAGCAGG + Intergenic
1102258351 12:111428899-111428921 CAGAGCCTGGGCGGGGATGCAGG + Intronic
1102405883 12:112673836-112673858 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1102502012 12:113359228-113359250 CAAAGTCTAGGGAAGGGAGCAGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102546179 12:113657648-113657670 GAGAGGCTGGGGTGGGAATCTGG - Intergenic
1102573031 12:113839124-113839146 CAGAGCCAGGGGAGGGAACTGGG + Intronic
1102812413 12:115835780-115835802 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1102953325 12:117044465-117044487 CAGAGTCTGGGGCTGGAAAGGGG + Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103176025 12:118864078-118864100 CAGTGTCTGGGCATGGAAGTGGG - Intergenic
1103230245 12:119324113-119324135 CCGAGTCTGGGGCAGGAAACTGG + Intergenic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103922247 12:124405109-124405131 TAGAGTCTGGAGTGGGAGGCAGG - Intronic
1104073248 12:125366016-125366038 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1104136203 12:125941315-125941337 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1104936777 12:132368817-132368839 CAGAGCCGGGGGAGGGCAGTGGG - Intergenic
1105583737 13:21724701-21724723 CAGAGGCTGTGGAGTCAAGCCGG - Intergenic
1105798856 13:23885285-23885307 CAGAGGCTAGGTAGGGTAGCAGG + Intronic
1105811739 13:24001646-24001668 CAGTGACTTGGGTGGGAAGCAGG + Intronic
1106113547 13:26797772-26797794 CAGAGCCTGGGGAGGGCTGAAGG + Intergenic
1106349072 13:28910177-28910199 CAGAGGCTGGGAAGGGTAACGGG - Intronic
1106388345 13:29310068-29310090 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1106792521 13:33169993-33170015 CAGAGGCTGAGGAGGGTAGTGGG + Intronic
1106967305 13:35086451-35086473 CAGAGTCTGGGAAGGGTACCAGG - Intronic
1107058635 13:36131732-36131754 CACCGTCGGGGGAGGGAAGGAGG + Intergenic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107417310 13:40212573-40212595 CAGAGTCTGTCGGGGGAGGCAGG - Intergenic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1107608883 13:42092582-42092604 TAGAGGCTGGGAAGGGAAACGGG + Intronic
1107630135 13:42334502-42334524 CTGAATCTGAGGAGGGAACCTGG - Intergenic
1107643556 13:42470411-42470433 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1107707966 13:43125700-43125722 CAGAGGCTGGGAAGGGAAGTCGG + Intergenic
1108131676 13:47308702-47308724 CAGAGACTGGGAAGGGTAGTTGG - Intergenic
1108138497 13:47392305-47392327 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1108326857 13:49341572-49341594 CAGAGGCTGGGGAAGGTAGGAGG + Intronic
1108328997 13:49366146-49366168 CAGAGGCTAGGAAGGGTAGCAGG + Intronic
1108645325 13:52421356-52421378 CAGAGGCTGGGGAGGGTAGGTGG + Intronic
1108701292 13:52946621-52946643 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1108769688 13:53684415-53684437 CAGAGGCTGGGAAGGGTATCAGG - Intergenic
1108973715 13:56409438-56409460 CAGAGTCTGGGAAGGGTTGTGGG + Intergenic
1109187171 13:59283934-59283956 TAGATTCTGGGTAGGAAAGCTGG - Intergenic
1109725392 13:66334193-66334215 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1109910291 13:68902153-68902175 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1110009352 13:70312349-70312371 CAGAGTCTGGGGAGGGATGGGGG + Intergenic
1110128233 13:71975224-71975246 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1110203569 13:72883328-72883350 CAGAGACTGGGAAGGGTAGTTGG + Intronic
1110234759 13:73205113-73205135 CAAAGGCTGAGGAAGGAAGCAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110679218 13:78288639-78288661 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
1110892079 13:80706304-80706326 AAGAGCCTGGGGGGGGAAGAGGG - Intergenic
1110910850 13:80961013-80961035 CAGAGGCTGGGAAGGGCAGCAGG - Intergenic
1110923827 13:81125081-81125103 TAGAGTCTGGGAAGGAAAGAGGG - Intergenic
1111001953 13:82196073-82196095 CAGAGTCTGGGAAGGGTATTGGG + Intergenic
1111244306 13:85515349-85515371 CAGGGTCAGTGGAGGAAAGCGGG + Intergenic
1111502559 13:89140798-89140820 CAGAGGCTGGGTAGGGTAGCAGG - Intergenic
1111542973 13:89692293-89692315 CAGAGGCTGGGGAAGGTAGTTGG + Intergenic
1111698274 13:91653367-91653389 CAGAGCCTGGGAAGGGTAGTAGG + Intronic
1111759705 13:92446246-92446268 CAGAGGCTGGGAAGGGTACCAGG - Intronic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1111832809 13:93351420-93351442 AAGAGTCTGGGAAGGGTAGGGGG + Intronic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1111957334 13:94773937-94773959 CAGATTATGGGGAGGGCAGATGG + Intergenic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112388203 13:98959659-98959681 CAGAGACTGGTGAGGGAGACAGG + Intronic
1112419754 13:99237471-99237493 CAGAGGCTGGGAAGGGTAGGAGG + Intronic
1112439604 13:99416255-99416277 GTGAGTCTGGGGAGGTCAGCAGG + Intergenic
1112531921 13:100212884-100212906 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1112713170 13:102153705-102153727 CAGAGGCTGGGAAGGCAAGGAGG - Intronic
1112790060 13:102993513-102993535 AAGAGGCTGGGGAGGAAAGCGGG - Intergenic
1112904282 13:104398004-104398026 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1113490498 13:110687984-110688006 TAAAGACTGGCGAGGGAAGCGGG + Exonic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1114531137 14:23397130-23397152 CTTAGTCTGGGGAGGACAGCTGG - Intronic
1114712335 14:24791272-24791294 CAGAGGATGGGGAGGGTAGGGGG + Intergenic
1114719308 14:24863189-24863211 CCTAGTCTGGGGAGGGCAGTGGG - Intronic
1114763862 14:25348467-25348489 CAGAGTCTGGGAAGGGTAGTAGG + Intergenic
1115200149 14:30844299-30844321 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1115276322 14:31613286-31613308 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
1115474330 14:33799621-33799643 CAGGGGCTGGGGCGGGGAGCAGG - Intronic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1115673536 14:35643877-35643899 CAGAGACTGGGAAGGGCAGTGGG + Intronic
1116034188 14:39608271-39608293 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1116045871 14:39741680-39741702 CAGAGGCTGGGAAGGCCAGCAGG - Intergenic
1116149393 14:41119776-41119798 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1116167581 14:41352699-41352721 CAGAGTCTGGGGAGGGTAGGGGG - Intergenic
1116256129 14:42558841-42558863 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1116337528 14:43676467-43676489 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1116438489 14:44922516-44922538 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
1116458371 14:45144322-45144344 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1116489396 14:45488364-45488386 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1116491979 14:45515444-45515466 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1116497290 14:45576783-45576805 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1116559341 14:46358744-46358766 CAGAGGCTGGGGAAGGGAGGAGG + Intergenic
1116577647 14:46595358-46595380 CAGAGGCTGGTCAGGGAAGAAGG - Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1117072017 14:52066265-52066287 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
1117264108 14:54067782-54067804 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117440031 14:55750965-55750987 CAGAGGCTGGGGTGGGAGGGGGG - Intergenic
1117460100 14:55936762-55936784 CAACCTCTGGGGAGGGAAGAAGG - Intergenic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117728212 14:58695048-58695070 CAGCCTCAAGGGAGGGAAGCTGG + Intergenic
1117742528 14:58833671-58833693 GACAGGGTGGGGAGGGAAGCAGG + Intergenic
1117744027 14:58849177-58849199 CAGAGTCTGGGAAATGAGGCTGG - Intergenic
1117765405 14:59076787-59076809 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1117780885 14:59230584-59230606 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1117856003 14:60034501-60034523 CAGAGTCTGGGACGGGGAGCGGG - Intronic
1118097378 14:62552617-62552639 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1118136476 14:63033583-63033605 CAGAGTCTGGTAGGGGAGGCAGG - Intronic
1118509688 14:66458027-66458049 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
1118659064 14:67987338-67987360 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1118659561 14:67993340-67993362 CAGAGGCTGGGGAGTGTAGCGGG - Intronic
1118798352 14:69166162-69166184 CAGAGCCTGGGAAGGGTAGTAGG + Intergenic
1118888086 14:69883287-69883309 CAGAGGCTGAGGAAGGAAGAGGG - Intronic
1118919336 14:70135735-70135757 CAGAGGCTGGTAAGGGAAGTGGG + Intronic
1119233445 14:72999480-72999502 CAGAGGCTGAGGTGGGAAGATGG + Intronic
1119640502 14:76310935-76310957 CAGAGTCTGGGGAGGAGAAAGGG - Intronic
1120017528 14:79490659-79490681 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1120262556 14:82205167-82205189 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1120299364 14:82686625-82686647 CAGAGTCTGGGAGGGGTAGTGGG - Intergenic
1120822281 14:88923068-88923090 CAGAGGCTGGGGAGGTTAGTAGG - Intergenic
1121114733 14:91335622-91335644 TAGCCTCTGGGGAGGGAAGCAGG - Intronic
1121153322 14:91658376-91658398 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121472656 14:94167284-94167306 CAGGGTTTGGGGTGGGAAGGAGG + Intronic
1121594360 14:95148253-95148275 CAACCTCTGGGGAGGGAAGAGGG - Intronic
1121695824 14:95911143-95911165 CTGAGGCTGGAGGGGGAAGCGGG - Intergenic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121828720 14:97031873-97031895 CAGAGGCTGGGAAGGAAAGCGGG + Intergenic
1122010526 14:98742698-98742720 CACAGTCTAGGGAGGGAGACAGG - Intergenic
1122234479 14:100323944-100323966 CAGAGTCTGGCCTGAGAAGCAGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122265184 14:100543402-100543424 CAGGGTCTGTGGAGGGCAACTGG + Intronic
1122349734 14:101081889-101081911 CAGAGACTGGGAAGGGGAGTGGG + Intergenic
1122470381 14:101962193-101962215 CAGACTCTGGGCAGGGCAGGGGG - Intergenic
1122690936 14:103531927-103531949 GGGAAGCTGGGGAGGGAAGCTGG + Intronic
1122946784 14:105014927-105014949 CAGAGTCAGGGGAGGCAGCCAGG - Intronic
1123501529 15:20887876-20887898 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123503625 15:20915489-20915511 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123558782 15:21461575-21461597 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123560872 15:21489163-21489185 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123595011 15:21898856-21898878 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1123597111 15:21926454-21926476 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123767389 15:23495143-23495165 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1123839271 15:24230236-24230258 CAGAGGCTGGGAATGGTAGCAGG - Intergenic
1123868201 15:24543554-24543576 CAGAGGCTGGGAATGGTAGCAGG - Intergenic
1123889580 15:24763387-24763409 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1124104558 15:26725323-26725345 CAGCTTCTGGGGAGGGATGGTGG - Intronic
1124104969 15:26729323-26729345 CAGCTTCTGGGGAGGGATGGTGG - Intronic
1124202182 15:27687923-27687945 CACAGCCTGGGGGAGGAAGCAGG - Intergenic
1124221548 15:27854088-27854110 CAGAATCTGGGGTGGGGAGGAGG - Intronic
1124329294 15:28795371-28795393 TAGAGTTTTGGGAGGGAAGGTGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124395004 15:29293603-29293625 CAGAGAGTGGGGATGCAAGCAGG + Intronic
1124508285 15:30298014-30298036 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
1124554654 15:30713147-30713169 CAGGGGCTGGGAAGGGAAGTGGG - Intronic
1124576683 15:30915289-30915311 CAGAGGCTGGGAGGGGAAGGGGG + Intronic
1124676594 15:31692533-31692555 CAGGGGCTGGGAAGGGAAGTGGG + Intronic
1124735271 15:32240642-32240664 CAGAGGCTGGGAAGGGGAGTGGG - Intergenic
1125134074 15:36321157-36321179 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1125393284 15:39219161-39219183 CAGAGGCTGGGAAGGGTAGCTGG + Intergenic
1125829003 15:42699320-42699342 CAGAGGCTGGGGAGGGGATCAGG - Intronic
1126103627 15:45134320-45134342 CAACCTCTGGGGAAGGAAGCCGG + Intronic
1126271483 15:46823344-46823366 CAGAGGCTGGGGAGGTTTGCAGG + Intergenic
1126365448 15:47889538-47889560 CAGAGTCTGGGAAGGGTAGTGGG + Intergenic
1126533983 15:49740982-49741004 CAGAAGCTGGGGAGGGTAGGAGG + Intergenic
1126581582 15:50247084-50247106 CAGAGGCTGGGAAGGGTAGCAGG + Intronic
1126771284 15:52058845-52058867 CAGAATCTGTGTAGGGAAGCTGG + Intronic
1126795695 15:52259017-52259039 CTGAGACTGGTGAGGGCAGCAGG - Intronic
1126809780 15:52390130-52390152 CAGAGGCTAGGAAGGGTAGCAGG + Intronic
1126846849 15:52768025-52768047 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1126851849 15:52801871-52801893 TAGAGTCTGCAGAGGGAGGCGGG - Intergenic
1127256390 15:57297221-57297243 CAGAGGCTGAGGATGCAAGCAGG + Intronic
1127264039 15:57346850-57346872 CAGAATCTGGGGTGGGGGGCAGG + Intergenic
1127395432 15:58540903-58540925 CAGAGTCTGAGGTGGGAGGATGG - Intronic
1127412617 15:58724319-58724341 CAGATTCTAGGGTGGGAGGCAGG + Intronic
1127459360 15:59183831-59183853 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1127624216 15:60764258-60764280 GAGAGGCTGGGGTGGGAAGCGGG + Intronic
1127653181 15:61029340-61029362 ATGAGACTGAGGAGGGAAGCAGG + Intronic
1127775975 15:62264559-62264581 CAGGGCCTGGACAGGGAAGCTGG + Intergenic
1127780761 15:62313130-62313152 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1127963648 15:63908239-63908261 CAGAGTCTGGGGTGGGAGTGTGG - Exonic
1128233471 15:66051356-66051378 AAGAGGCTGGGATGGGAAGCAGG + Intronic
1128380492 15:67108365-67108387 CACAGGGTGGGGAGGCAAGCAGG - Intronic
1128442026 15:67719053-67719075 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128900372 15:71415683-71415705 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1129135779 15:73549357-73549379 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1129334314 15:74843259-74843281 CAGAGACAGGGGAGGGGCGCCGG - Intronic
1129584254 15:76847182-76847204 CAAAGTCTGGTAAGGGTAGCAGG + Intronic
1129654426 15:77514630-77514652 AAGAGGCTAGGGAGGGAGGCAGG + Intergenic
1129825375 15:78631327-78631349 CTCATTCTGGGGAGGGAAACGGG + Exonic
1129826332 15:78637443-78637465 CAGTGCCGGGGCAGGGAAGCAGG + Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130399871 15:83540938-83540960 CGGAGGCTGGGAAGGGTAGCAGG - Intronic
1130426737 15:83808973-83808995 CAGAGACTGGGGAGGACAGGGGG + Intronic
1130606351 15:85320661-85320683 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1130797834 15:87229480-87229502 CAGAGGCTGGGAAACGAAGCAGG + Intergenic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131509859 15:93044039-93044061 TGGAGTCTGGGGAGAGGAGCAGG - Intronic
1131634543 15:94217307-94217329 CAGAGGCTGGGAAGGGTAGCAGG + Intergenic
1131949944 15:97671213-97671235 CAGAGCCTGGGAAGGGTAGTGGG - Intergenic
1131950012 15:97672006-97672028 CAGAGCCTGGGAAGGGTAGTAGG - Intergenic
1202967130 15_KI270727v1_random:188734-188756 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1202969217 15_KI270727v1_random:216327-216349 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1132525955 16:414857-414879 CAGAGCCTGTGGAGGGACCCAGG - Intergenic
1132688043 16:1170446-1170468 CAGAGGCAGGGGAGGGGAGCGGG + Intronic
1133026989 16:2992838-2992860 AAGAGGGTGGGGACGGAAGCGGG + Intergenic
1133324799 16:4936295-4936317 CAGAGGGTGGGGAGGTAAGGGGG + Intronic
1133610966 16:7432971-7432993 CAGCTTCTGTGGAGGGAAACAGG + Intronic
1133629209 16:7603184-7603206 TAGAGTCTATGGAAGGAAGCAGG + Intronic
1134323493 16:13185653-13185675 CAGAGTCCAGTGAGGGAAACAGG - Intronic
1134375355 16:13667110-13667132 CAGAGGCTGGGAAGGGTAGTCGG - Intergenic
1134563734 16:15232834-15232856 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1134589028 16:15436690-15436712 CAGAGGCTGGGGAGGGTATTGGG - Intronic
1134738760 16:16523859-16523881 CAGAGCCTGGGAAGGGTAGTGGG - Intergenic
1134928739 16:18188294-18188316 CAGAGCCTGGGAAGGGTAGTGGG + Intergenic
1135151328 16:20009010-20009032 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1135199546 16:20425143-20425165 CAGAGGCTGGGAAGGGTAGTCGG - Intronic
1135219148 16:20598465-20598487 CAGAGGCTGGGAAGGGTAGTCGG + Intergenic
1135248288 16:20876941-20876963 CAGAGGCAGGGAAGGGGAGCGGG + Intronic
1135549850 16:23389677-23389699 CAGTGTCTGGGGTGGGACCCTGG + Intronic
1135604766 16:23813912-23813934 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1135604783 16:23813952-23813974 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1135876431 16:26204597-26204619 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1135898830 16:26436064-26436086 CAGAGTCTGGGAAGGCTAGAGGG - Intergenic
1136097108 16:27964764-27964786 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
1136271229 16:29149538-29149560 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1137226788 16:46520469-46520491 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1137269196 16:46891915-46891937 CAGAGTCTGGGAAGGGCAGTAGG - Intronic
1137392342 16:48092098-48092120 CCGAGCCTCCGGAGGGAAGCTGG + Intronic
1137736633 16:50729307-50729329 CAGAGTGTGGGGAGGTAATGGGG + Intronic
1137885658 16:52100853-52100875 CAGAGGCTGGGAAGGGGAGCAGG - Intergenic
1137963080 16:52904841-52904863 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1138084174 16:54118736-54118758 CGGAGGCTGGGAAGGGAAGAAGG - Exonic
1138279388 16:55761436-55761458 CAGAGCCTGGGGAGGGGACAGGG + Intergenic
1138289141 16:55832241-55832263 CAGAGCCTGGGGAGGGGACAGGG - Intronic
1138469156 16:57218487-57218509 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1138549302 16:57738858-57738880 CAGAGCCTGGGGAGAGCAACAGG + Intronic
1139085736 16:63583489-63583511 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1139364604 16:66426189-66426211 CAGCGTCTGGGTAGGGCTGCAGG - Intergenic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1139646982 16:68338575-68338597 CACAGCCTGGGGAAGGCAGCGGG + Intronic
1139884282 16:70197590-70197612 CAGAGCCTGGGCTGGGAAGCGGG + Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140264661 16:73409959-73409981 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1140368234 16:74397906-74397928 CAGAGCCTGGGCTGGGAAGCGGG - Intergenic
1140566695 16:76051054-76051076 TAGAGGCTGGGAAGGGTAGCTGG - Intergenic
1140665028 16:77219426-77219448 TAGAGTGTGGGGAGGCATGCAGG + Intergenic
1140949154 16:79799279-79799301 CAGAGACTGGGGAGGGGTGTGGG - Intergenic
1140968857 16:79993714-79993736 CATAATCTAGTGAGGGAAGCAGG + Intergenic
1140980836 16:80107551-80107573 CAGAGACTGGGAAAGGAAGAGGG + Intergenic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141651575 16:85395798-85395820 CAGAGCCTGGGGAGGGTGGGCGG - Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1141924310 16:87157331-87157353 CAGAGGCTGGGGAGGGGAGTGGG + Intronic
1142074841 16:88111527-88111549 CACAGGCTGGGAAGGGAAGTGGG - Intronic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1142439734 16:90089028-90089050 CAGAGTCTGGGAAGGGCAGTGGG + Intronic
1142495821 17:305813-305835 AAGGGGCTGGGGAGGGAGGCTGG - Intronic
1142646212 17:1315513-1315535 GGGAGCCTGGGGAGGGCAGCGGG - Intergenic
1142685974 17:1577199-1577221 CAGAGTCTGGGGCCTGGAGCTGG - Intronic
1142698657 17:1646859-1646881 AAGAGTGTGGGGAGGGAGGAAGG - Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142765016 17:2059797-2059819 CTGGGACTGGGGAGGGAGGCAGG - Intronic
1142978542 17:3658868-3658890 CAGAGGCTGGGGCGGGACACGGG + Intronic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143167828 17:4907037-4907059 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1143370436 17:6435833-6435855 CAGATTCTGGGGAGGGGAGGGGG - Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143420350 17:6786338-6786360 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
1143580338 17:7821951-7821973 GAGAGTTTGGGGTGGGAGGCAGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143675211 17:8427402-8427424 CAAAGTCTTGGAAGGGAGGCTGG + Intronic
1143756558 17:9072034-9072056 CCGAGAGTCGGGAGGGAAGCCGG + Intronic
1143854296 17:9837266-9837288 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1143943678 17:10570407-10570429 CAGAGGCTGGGAAGGGAAGTAGG - Intergenic
1143999456 17:11039343-11039365 CAGAGTCTTAGGACAGAAGCAGG - Intergenic
1144013848 17:11175070-11175092 CAGACTATGGAGAGGCAAGCAGG + Intergenic
1144124069 17:12184330-12184352 TAGCCTCTGGGGAGGGAAGTGGG - Intergenic
1144155139 17:12492997-12493019 CAGAGACAAGGGAGGGGAGCTGG + Intergenic
1144237287 17:13273936-13273958 CAGAATATAGGGAGGGAAGGAGG - Intergenic
1144322878 17:14147491-14147513 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1144430227 17:15184337-15184359 CAGAGGTTGGGAAGGGTAGCAGG + Intergenic
1144500890 17:15786315-15786337 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1144716282 17:17437953-17437975 CAGAGGCTGGGAAGGGCAGGAGG + Intergenic
1144777287 17:17791303-17791325 TAGTGTCTGGGGATGGATGCAGG - Intronic
1145163052 17:20588977-20588999 CAGAGCCGGGGGAGGGACGGGGG + Intergenic
1145309058 17:21691601-21691623 CAGTGCCTGGAGAGTGAAGCTGG + Intergenic
1145779996 17:27556703-27556725 CAGAGTCAGAGGAGGGAACAGGG + Intronic
1145971679 17:28959959-28959981 AAGGCTCTGGGGAGGGAAGTAGG - Intronic
1146117814 17:30157666-30157688 CAGAGACTGGGAAGGGGAGGAGG - Intronic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1146594517 17:34157227-34157249 TGGAGACTGGGGACGGAAGCGGG + Intronic
1146700578 17:34956166-34956188 AAGAGGCTGGAGAGGGAAGTGGG - Intronic
1147144408 17:38476988-38477010 TAGGGTCTGGAGAGGGAAGGAGG + Intronic
1147206173 17:38839177-38839199 CAGAGTCTGGGGAGGGGAAAAGG - Intronic
1147256418 17:39184859-39184881 CTCTGTCTGGGGGGGGAAGCAGG + Exonic
1147475387 17:40706878-40706900 CAGAGGCTGGGAAGGGAAACGGG - Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148135335 17:45288276-45288298 AAGATTGTGGGGAGGGCAGCTGG - Intronic
1148290963 17:46448851-46448873 CAGAGACTGGGGAGGGTGACTGG - Intergenic
1148313152 17:46666556-46666578 CAGAGACTGGGGAGGGTGACTGG - Intronic
1148323208 17:46769754-46769776 AAGGGTTTGGGGAGGGTAGCCGG + Intronic
1148797682 17:50204914-50204936 CAGAGTCTGGGGATAGACCCCGG + Intergenic
1148806666 17:50267289-50267311 CAGAGCCTGGGGGAGGAAGCTGG - Intergenic
1148996634 17:51716051-51716073 CAGAGTCTGGGAAGGGTAGTAGG - Intronic
1149118586 17:53132041-53132063 CAGAGGCTGGGGAGGGTAAGGGG + Intergenic
1149153044 17:53592929-53592951 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1149184235 17:53978494-53978516 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
1149199540 17:54166843-54166865 CAGAGACTGGGAAGGGTAGCAGG + Intergenic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149282887 17:55128299-55128321 CAGAGTCTGGGCAGGTAAGGAGG + Intronic
1149299610 17:55292977-55292999 CAGAGGCTGGGAAGGTTAGCGGG + Intronic
1149411877 17:56417050-56417072 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1149596816 17:57869082-57869104 GAAAAGCTGGGGAGGGAAGCGGG + Intronic
1149790029 17:59468672-59468694 CAGAGTCTGGAGAGCTAAGCAGG + Intergenic
1149902885 17:60497339-60497361 CAGAGGCTGGGAAGGGTAACTGG + Intronic
1149906681 17:60532999-60533021 CAGAGGCTGGGAAGGGTAGTCGG + Intergenic
1149981364 17:61313930-61313952 CAGAGTCTCGTGGGGGAAGCCGG + Intronic
1150191993 17:63252538-63252560 CAGAGGCTGGGAAGGGTCGCTGG - Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1150967344 17:69986989-69987011 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1151128873 17:71875217-71875239 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1151251788 17:72841540-72841562 CAGAGGCTGGGAAGGGCAGTCGG + Intronic
1151272847 17:73010186-73010208 CAGAGTCTGGGGTGGGGTCCCGG + Intronic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1151535375 17:74736398-74736420 CAGAGAGTGGGGAGTGCAGCTGG - Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152044727 17:77928440-77928462 CAGGGTGTGGGGAGGGTAGTGGG + Intergenic
1152096246 17:78273307-78273329 CAGAGCCTGGGAAAGGGAGCAGG - Intergenic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152214243 17:79023369-79023391 CAGAGTCTAGGGATGGAGACTGG + Intronic
1152264568 17:79286852-79286874 CAGTGTCTGAGGAGGGCACCAGG - Intronic
1152300755 17:79494256-79494278 CAGAGTCTTGGTGGGGAAGCTGG + Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152695275 17:81741036-81741058 GAGGGGCTGGGGAGGGAGGCTGG - Intergenic
1152781870 17:82230348-82230370 CAGAGTCTGGGGTGGGCACCTGG + Intronic
1152814589 17:82399900-82399922 GACACTCTGGGGAGGGAAGGGGG + Intronic
1152957828 18:54532-54554 CAGAGGCTGGGAAGGGCAGTGGG - Intronic
1153445871 18:5172184-5172206 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1153511620 18:5860806-5860828 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1153993898 18:10423191-10423213 CAGAGTCTGTGGAGGGCGGCTGG - Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1154367914 18:13727753-13727775 CACAGACTGGGAAGGGTAGCAGG - Intronic
1155075729 18:22352593-22352615 CAGAGGCTGGGGAAGGTAGAGGG - Intergenic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155317193 18:24583822-24583844 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1155509049 18:26559091-26559113 CAGAGACTGGGAAGGGTAGTGGG + Intronic
1155767929 18:29659126-29659148 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1155968545 18:32058774-32058796 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1156025435 18:32648576-32648598 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1156156365 18:34307424-34307446 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1156292401 18:35759450-35759472 CAGAGGCTGGGGAGGGGGGAGGG + Intergenic
1156325157 18:36067909-36067931 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1156445558 18:37234015-37234037 CATTGTCTGAGGAAGGAAGCAGG + Intergenic
1156475048 18:37400642-37400664 CAAAGCCTGGTGTGGGAAGCTGG - Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156810646 18:41245932-41245954 CAGAGGCTGGGAAAGGAAGGAGG - Intergenic
1156990887 18:43406231-43406253 CAGGCTCTGGGGAGGCAAGCAGG - Intergenic
1157716138 18:49888699-49888721 AAGAGGCTGGGGAGAGGAGCTGG - Intronic
1157915908 18:51663718-51663740 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1158372700 18:56827550-56827572 CAGAGTCTGGGAAGGGTAGTGGG + Intronic
1158622808 18:59047424-59047446 CAGTGTCTGGGCAGGAGAGCAGG + Intergenic
1158881854 18:61787239-61787261 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1158900643 18:61958620-61958642 TCGAGGCTGCGGAGGGAAGCAGG + Intergenic
1159273168 18:66180276-66180298 AAGAGACTGGGGAGGGTAGGGGG - Intergenic
1159325783 18:66915384-66915406 CAGAGCCTGGGAAGGGTAGTTGG + Intergenic
1159423792 18:68257792-68257814 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1159562857 18:70014371-70014393 CAAAGTCTGGGCAGATAAGCTGG + Intronic
1159832432 18:73293749-73293771 CAGAGGCTGGGAACGGTAGCTGG + Intergenic
1159895689 18:73993884-73993906 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1160037305 18:75313717-75313739 CAGGGTCTGGGGAGGTGAGGAGG + Intergenic
1160060696 18:75526566-75526588 TAGAGTCTGGGGAGGTTGGCTGG + Intergenic
1160060718 18:75526677-75526699 TAGAGTCTGGGGAGGTTGGCTGG + Intergenic
1160120618 18:76127536-76127558 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1160243430 18:77138530-77138552 TAGAGTCTGGCGTGGGCAGCAGG + Intergenic
1160433962 18:78832013-78832035 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160433999 18:78832155-78832177 CAAAGGCTGAGGAGGGAAGGAGG - Intergenic
1160434013 18:78832201-78832223 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434038 18:78832297-78832319 CAAAGGCTGAGGAGGGAAGGAGG - Intergenic
1160434061 18:78832389-78832411 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434096 18:78832527-78832549 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434145 18:78832757-78832779 CAGAGGCTGAGAAGGGAAGGGGG - Intergenic
1160434160 18:78832803-78832825 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434188 18:78832899-78832921 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160680064 19:408396-408418 CAGCGTCTGGGAAGAGAAGCAGG + Exonic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161143427 19:2662792-2662814 CAGCCTCTGGGGAGGGGAGAAGG - Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161402239 19:4071977-4071999 CAGAGGCTGGGGAGGGGAATGGG + Intergenic
1161636655 19:5393485-5393507 GGGAGTCTGGGGAGAGGAGCTGG - Intergenic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162210669 19:9089197-9089219 TAGAGTCTGGGAAGGGTAGAGGG - Intergenic
1162223654 19:9201188-9201210 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162402370 19:10453958-10453980 CAGACTCTGTCCAGGGAAGCAGG - Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1162931267 19:13959134-13959156 CAGAAGCTGGGGAGGGCAGGGGG - Exonic
1163096409 19:15060754-15060776 CAGAGGCTGGGAAGGGAAGCGGG + Intergenic
1163296423 19:16415787-16415809 CAGGGTCTAGGAAGGGACGCTGG - Intronic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163518642 19:17779427-17779449 CAGAGACTGGGGAGGCAACCAGG + Intronic
1163686169 19:18713006-18713028 CAGGGGCTGGGGAGGGGAACGGG - Intronic
1163737136 19:18988359-18988381 CAGGGTTTGGGGGGTGAAGCTGG + Intergenic
1164794385 19:31014507-31014529 AAGGGTCGGGGGAGGGAAGAAGG + Intergenic
1164968568 19:32509915-32509937 CAATGTCAGGGGAAGGAAGCTGG + Intergenic
1165007724 19:32820104-32820126 CAGAGCCTGGGGAGGGGCGGTGG + Intronic
1165735697 19:38174078-38174100 CTGAGGCTGGGGAAGGATGCAGG + Intronic
1166006013 19:39907179-39907201 TGGAGTTTGGGGAGGGGAGCAGG - Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166398119 19:42457381-42457403 CAGAGTCCTGGGAGGCCAGCTGG + Intergenic
1166793123 19:45409573-45409595 CAGTCTCTGGGGAGGGATTCTGG - Exonic
1167134664 19:47609489-47609511 CCGGGTCTGGGCAGGGAAGCCGG - Intronic
1167276976 19:48544891-48544913 CAGAGACTGGGGAGGGATGCTGG - Intergenic
1167607532 19:50489456-50489478 CAGAGACCGGGGCAGGAAGCAGG + Exonic
1167788242 19:51653522-51653544 CAGAGACTGGGGAGGATAGAGGG + Intergenic
1167798294 19:51724806-51724828 CAGGGTCTGGGGTGGAGAGCTGG + Intergenic
1168094621 19:54107637-54107659 CCCAGTGTGGGGAGGAAAGCTGG - Intronic
1168383093 19:55940812-55940834 CAGAGGCTGGGGAGGGTTGTGGG - Intergenic
1168488187 19:56783015-56783037 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1168713857 19:58516156-58516178 CTGAGGCTGGGTAGGGAAGCAGG - Intronic
1168717896 19:58539802-58539824 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718045 19:58540422-58540444 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718288 19:58541390-58541412 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718397 19:58541853-58541875 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718489 19:58542240-58542262 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718539 19:58542436-58542458 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718619 19:58542784-58542806 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
925021440 2:572619-572641 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
925115918 2:1378310-1378332 CAGAAACTGGAGAGGGAACCAGG - Intronic
925216104 2:2097084-2097106 AAGAGGCTGGGGAGGGAGGCTGG - Intronic
925440234 2:3879356-3879378 ATGAGTCTGCAGAGGGAAGCCGG + Intergenic
925608320 2:5682017-5682039 CAGAGTCTGGGAAGTGTAGCAGG + Intergenic
925993283 2:9270717-9270739 CAGAGGCTGGGAAGGGTAGGTGG - Intronic
926025827 2:9543755-9543777 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
926039838 2:9664217-9664239 CAGAAGCTGGGGAGGGCAGCTGG - Intergenic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926065391 2:9835427-9835449 CAGAGTCTGGGCAGGGTAGTTGG + Intergenic
926106272 2:10153871-10153893 CAGGGACTGGGGAGGGGAGAAGG + Intronic
926420412 2:12691138-12691160 CAGAGTCTGGGGAATGGAGTGGG + Intergenic
926519275 2:13889965-13889987 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
926685400 2:15694191-15694213 CTGAGACTGGGGTGGGGAGCGGG - Intronic
926717498 2:15936606-15936628 AAGAGTCTGAGGAGGGCAGATGG - Intergenic
926743305 2:16129947-16129969 CTGAGTCTTGGGAGGGATGGCGG - Intergenic
926833497 2:16990890-16990912 CAGAGGCTGGGAAGGGTTGCTGG - Intergenic
926940305 2:18128838-18128860 CAGAGGCTGGGAAGGGTAGACGG + Intronic
926992755 2:18697787-18697809 CAGAGTCTAGAGAGGCAGGCAGG + Intergenic
927008428 2:18876555-18876577 CAGAGGCTGCGGAGAGGAGCAGG - Intergenic
927110172 2:19858905-19858927 CAGATCCTCAGGAGGGAAGCTGG + Intergenic
927361962 2:22246403-22246425 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
927417427 2:22893433-22893455 CAGCTACTGGGGAGGAAAGCAGG + Intergenic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928079092 2:28292841-28292863 CAGACTCTGGGGTGAGAAGAAGG + Intronic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928169849 2:28996395-28996417 CAGAGACTGGGAAGAGAAGGGGG - Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928384797 2:30857972-30857994 CAGAGGCTGGGAAGGGAAGTTGG + Intergenic
928448686 2:31357539-31357561 CAGAGGCTGGGGAGGGTAGGGGG + Intronic
928474034 2:31606140-31606162 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
928536385 2:32245465-32245487 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
928707351 2:33964590-33964612 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
930161519 2:48162301-48162323 CAGAGTCTGAGAAGAGAAGGAGG + Intergenic
930169819 2:48239819-48239841 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
930229523 2:48828480-48828502 CAGAGTCTTGAGAGGGAACATGG + Intergenic
930363844 2:50414022-50414044 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
930728275 2:54703457-54703479 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
930884969 2:56314951-56314973 CAGGCTCTGGGAAGGGAAGGAGG - Intronic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
930891822 2:56398805-56398827 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
930953849 2:57179118-57179140 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
930962729 2:57280472-57280494 CAGAGGCTGGGAACGGTAGCAGG + Intergenic
930970503 2:57389421-57389443 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931297627 2:60944406-60944428 AAGATTCTGGGGAGAGGAGCGGG + Intronic
931486034 2:62693016-62693038 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
931609462 2:64082819-64082841 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
931689414 2:64822544-64822566 CAGCTTCTGGTGAGGGAATCAGG - Intergenic
931738714 2:65222522-65222544 CAGAGTCTGGGAAGGGAAACTGG + Intergenic
931764898 2:65446301-65446323 CAGAGGCTGGGAAGGGTAGTCGG - Intergenic
931789524 2:65652219-65652241 CCGAGTCTGGAGAGTCAAGCAGG - Intergenic
931870704 2:66456508-66456530 CAGATTCTGAAGAGGGATGCTGG + Intronic
931927671 2:67091949-67091971 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932010630 2:67974200-67974222 CAGAGTCTGGGAAGGGTTGTGGG - Intergenic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932139005 2:69258906-69258928 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
932211106 2:69931328-69931350 CAGAGGCTGGGAAAGGTAGCGGG - Intronic
932306401 2:70706570-70706592 CAGAGCCTGGGGAGGAGGGCAGG + Intronic
932401613 2:71484667-71484689 CAGAGGCAGGGAAGGGTAGCAGG - Intronic
933098346 2:78217134-78217156 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
933348632 2:81124429-81124451 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
933610986 2:84435079-84435101 ACAAGTCTGGAGAGGGAAGCTGG - Intronic
933617642 2:84499191-84499213 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
934159938 2:89239169-89239191 AAGATTCTGGGGACGGAATCGGG + Intergenic
934207342 2:89943265-89943287 AAGATTCTGGGGACGGAATCGGG - Intergenic
934763530 2:96868814-96868836 CAGAGTCGCGGGAGCGCAGCGGG - Intronic
934902444 2:98171541-98171563 ATGAGTCTGGAGAGGGAAGCAGG + Intronic
934921837 2:98350132-98350154 CAGAGCCTGGGGGCAGAAGCCGG - Intronic
934949305 2:98565578-98565600 CTGAGACTGGGGAGAGTAGCAGG + Intronic
935018085 2:99203089-99203111 CAGAGACTGGGAAGGGTAGTGGG - Intronic
935533087 2:104259652-104259674 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
935627364 2:105182381-105182403 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
936286785 2:111187343-111187365 CAGAGTCAGGGGAGGTATGCAGG + Intergenic
936417129 2:112326362-112326384 CAGAGACTGGGAAGGGTAGCTGG - Intronic
936519198 2:113201236-113201258 GAGCAGCTGGGGAGGGAAGCTGG + Exonic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
936951175 2:117979094-117979116 AAGAGTGTGGGGAGTGAAGCTGG - Intronic
937033450 2:118761070-118761092 CAGAAGCTGGGGAGGGGAGTTGG + Intergenic
937116604 2:119409573-119409595 CAGAGGCTGAGAAGGGTAGCTGG - Intergenic
937127698 2:119484844-119484866 CAGAGACTGGGGAGAGATGGAGG + Intronic
937216101 2:120314600-120314622 AGGAGGCTGGGGAGGGAAGGAGG - Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
937483352 2:122287174-122287196 CAGAGGCTGGGAAGGGAAGCAGG + Intergenic
937487746 2:122333430-122333452 CAGAGGCTGGGAAGGGTAGTCGG - Intergenic
937574173 2:123399016-123399038 CACAGCCTGCGGAGGGAAGGCGG - Intergenic
937628721 2:124074181-124074203 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
937629046 2:124078796-124078818 GAGTGTCTGGAGAGGGATGCAGG + Intronic
938109270 2:128553203-128553225 CAGAATCTGAGGAGGGCAGTGGG - Intergenic
938113785 2:128589895-128589917 CACAGCCTGGGGAGGGAAAGTGG + Intergenic
938394417 2:130932060-130932082 CAGGGTCTGGGGAGGGGAAATGG - Intronic
938619791 2:133038462-133038484 CAGAGGCTGGGAAGGGTATCAGG + Intronic
938771019 2:134500811-134500833 CAGAGACTGGGGAGGGGAGGGGG + Intronic
939177931 2:138771740-138771762 CAGAGTCGGGGCAAGGCAGCTGG + Intronic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939935900 2:148293230-148293252 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
939948804 2:148443736-148443758 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
940184286 2:150965785-150965807 CAGAGGCTGGGAAGGGTAGAAGG - Intergenic
940520393 2:154738266-154738288 CAGAGGCTGGGAAGGGAGGTGGG + Intronic
940524158 2:154791001-154791023 CAGCTTCTGGGGAGAGAAGGAGG - Intronic
940699801 2:157026658-157026680 CAGAGTCTGGGAAGGGTAGTAGG + Intergenic
940750632 2:157623590-157623612 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
940795895 2:158078620-158078642 CAGAGGCTGGGAAGAGTAGCAGG + Intronic
940893501 2:159057749-159057771 CAAAGCCTGGTGAAGGAAGCAGG + Intronic
940990941 2:160095774-160095796 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
941106847 2:161364131-161364153 CAGAGTCTGGCCAGGGCAGTTGG - Intronic
941134063 2:161691306-161691328 CAGAGGCTGGGAAGGGTAGGTGG + Intronic
941207920 2:162597523-162597545 CAGAGGCTGGGGAGGTATGAAGG + Intronic
941277257 2:163505211-163505233 CAGAGTCTGGGAAGGAAAGTGGG - Intergenic
941290479 2:163667812-163667834 CAGAGTCTTGTGAGGGAGGAAGG - Intronic
941341314 2:164308640-164308662 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
941792151 2:169564718-169564740 CAGAGGCTGGGAAGGGTAACGGG - Intronic
942058274 2:172205397-172205419 CAGATCCTGGGGAGGCCAGCAGG + Intergenic
942076046 2:172358081-172358103 CAGGGTTTGGGGAGGAGAGCGGG + Intergenic
942276724 2:174328536-174328558 CAGACTTTGGGCAGGGAAGGCGG + Intergenic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942327703 2:174789609-174789631 CAGAGGCTGGGAAGGGATGGAGG - Intergenic
942352705 2:175069561-175069583 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
942395627 2:175545483-175545505 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
942524133 2:176835178-176835200 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
942778128 2:179609218-179609240 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
942834032 2:180271096-180271118 CAGAGGCTGGGAAGGGTAGGAGG - Intergenic
943161126 2:184252635-184252657 CAGAGTCTGGGAAGGGTCGTGGG + Intergenic
943342622 2:186698784-186698806 CAGAGTCTGGGAAGGGTATTGGG - Intronic
943400246 2:187399930-187399952 TGGAGTCTGGGGTGGGTAGCAGG + Intronic
943582427 2:189700680-189700702 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
943708079 2:191057170-191057192 CAGAGGCTAGGAAAGGAAGCAGG - Intronic
944133022 2:196367639-196367661 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
944652804 2:201848544-201848566 GGGAGTGTGGGGAGGGAAGATGG - Intronic
945161191 2:206892844-206892866 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
945336922 2:208603451-208603473 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
945364386 2:208933539-208933561 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
945527843 2:210910826-210910848 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
945576193 2:211532132-211532154 CAGAGTCTGGGAAGGGTTGTGGG + Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
946097858 2:217291186-217291208 AAGTGTCTGGGTAGGAAAGCAGG + Intronic
946174956 2:217916907-217916929 CAGAGAATGGGCAGGGAGGCCGG + Intronic
946301598 2:218827643-218827665 CAGAGTCAGGCCAGGGGAGCCGG + Intronic
946447541 2:219752335-219752357 TAGAGGCTGGGAAGGGTAGCAGG - Intergenic
946452100 2:219789082-219789104 GAGAGAGTGGGGAGGGAAGGAGG - Intergenic
946516100 2:220412839-220412861 CACAGTGTGGGGAGGCCAGCGGG + Intergenic
946985270 2:225265005-225265027 CAGAGCCTGGGAAGGGTAGTGGG + Intergenic
947038526 2:225887806-225887828 CAGAGGCTGGGAAGGGTAGAAGG + Intergenic
947388327 2:229615036-229615058 CATAGTCAAGGCAGGGAAGCTGG + Intronic
947461110 2:230305896-230305918 CTGAGACTGGGGAGGCAATCCGG + Intronic
947564822 2:231186967-231186989 CAGAGGCTGGGAAGGGTAGCGGG - Intergenic
947675371 2:231974240-231974262 AAGGGACAGGGGAGGGAAGCTGG + Intronic
947774509 2:232697233-232697255 TGGAGAGTGGGGAGGGAAGCGGG + Intergenic
947870367 2:233433437-233433459 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
947915648 2:233830351-233830373 CAGAGACTAGGGAGAGAAGAGGG - Intronic
948131888 2:235607189-235607211 CTGGGTCTGGGCAGGGAAGGGGG - Intronic
948229996 2:236342494-236342516 CAGAGGCTGGGAAGGACAGCAGG + Intronic
948275969 2:236708954-236708976 AATAGTATGGGGAGTGAAGCTGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948759369 2:240181101-240181123 GAGAGTTTCAGGAGGGAAGCAGG - Intergenic
948883417 2:240871540-240871562 CAGAGGCTGGGGTGGGGACCAGG - Intronic
948893374 2:240917455-240917477 CAGAGTCCGGGGACGCAAGCAGG + Intergenic
949044698 2:241867088-241867110 CAGCTTCTGGGGAGGGCAGCTGG - Intergenic
1168742813 20:208582-208604 CAGAGTCTGGGAAGGGTAGTAGG - Intergenic
1168899324 20:1348125-1348147 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1168945683 20:1755011-1755033 CAGAGGCTGGGAAGGGTAGGAGG + Intergenic
1169492318 20:6081689-6081711 CAGAGCTTGGGGAGAGCAGCTGG + Intronic
1169543131 20:6622188-6622210 CATGGTCTGAGGAAGGAAGCTGG + Intergenic
1169629167 20:7607056-7607078 CAGAGTCTGGGAAGGGTATTGGG + Intergenic
1169740259 20:8885757-8885779 CAGAGGCTGGGGAGGGTAGTTGG - Intronic
1169852627 20:10069122-10069144 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1169912435 20:10657965-10657987 CAGAGTCTGAGAAGGGGATCTGG + Intronic
1169991655 20:11510886-11510908 TAGAGCCTGGGAAGGGCAGCAGG + Intergenic
1170188552 20:13620001-13620023 TAGAGTTTTGGGAGGGAAGGTGG - Intronic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1170477032 20:16725807-16725829 CAGAGGCTGAGGTGGGAAGGTGG - Intergenic
1170608559 20:17893212-17893234 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1170996791 20:21369062-21369084 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
1171167707 20:22986547-22986569 CAGAGCCGGGGGAGGGCAGGGGG + Intergenic
1171938433 20:31299677-31299699 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1172036945 20:32017886-32017908 GAGACTCTGGGGAGGGAGGAGGG + Intronic
1172115799 20:32572799-32572821 CAGAGCCTGTGCAGGGAAACTGG - Intronic
1172797160 20:37548501-37548523 CAGAGGCTGGGAAGGGTAGAGGG - Intergenic
1172800126 20:37570204-37570226 CAGAGGCTGGGAAGGGTTGCAGG - Intergenic
1172951690 20:38726660-38726682 TGGAGGCTGGGGAGGCAAGCAGG - Intronic
1173038489 20:39436039-39436061 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1173103294 20:40107608-40107630 CATTCACTGGGGAGGGAAGCTGG - Intergenic
1173162851 20:40664933-40664955 CAGAGTCTGGGAAGGGAGGCTGG + Intergenic
1173235417 20:41240660-41240682 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
1173365276 20:42379542-42379564 CTGAGCCTGTGGAGGGCAGCAGG + Intronic
1173557898 20:43980364-43980386 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1174335113 20:49854271-49854293 AAGAGGCTGGCGAGGGAGGCAGG - Intronic
1174400270 20:50272217-50272239 AAGAGTCTGGGCAGGGAATGGGG + Intergenic
1174501693 20:50989588-50989610 AGGAGGCTGGGGAGGGGAGCTGG + Intergenic
1174682532 20:52422649-52422671 CAGAGGCTGGGAAGGGAGGTAGG - Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175202063 20:57284852-57284874 CAGTCTCTGGTGATGGAAGCAGG - Intergenic
1175468490 20:59208964-59208986 CAGTGCCTGGGGAGCTAAGCAGG - Intronic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1176090762 20:63317695-63317717 GAGAGGATGGTGAGGGAAGCCGG - Intronic
1176194084 20:63829142-63829164 CAGGGGCTGGGGAGGGACGGAGG + Intronic
1176374428 21:6080135-6080157 CAGAGGCTGAGAAGGGAAGGCGG + Intergenic
1176376798 21:6090787-6090809 GAGAGGCTGGGGATGGGAGCCGG - Intergenic
1176822320 21:13668852-13668874 CAGAGGCTGGGAAAGGTAGCTGG - Intergenic
1177012863 21:15750088-15750110 CAGCATCCGGGGAGGGAAGAGGG + Intronic
1177246490 21:18531810-18531832 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
1178123987 21:29497959-29497981 CAGAGACTGGCAAGGGTAGCTGG - Intronic
1178205079 21:30455710-30455732 CAGCTTCTGGTGAGGGAATCAGG + Intergenic
1178205217 21:30456667-30456689 CAGCTTCTGGTGAGGGCAGCAGG + Intergenic
1178624691 21:34204867-34204889 CAGAGACTGGGAAAGGAAACTGG - Intergenic
1178679420 21:34660083-34660105 CAGACACTGGGGAGGGAGGATGG - Intergenic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1178934733 21:36851510-36851532 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1179042326 21:37815105-37815127 CAGAGACTGGGGAGGGTAGTGGG + Intronic
1179059313 21:37965115-37965137 CAGAGGCTGGGGAGAGAAGGGGG + Intronic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179223136 21:39427272-39427294 TACAGTCTGGGCAGGGAAGGAGG + Intronic
1179607401 21:42525925-42525947 CAGAGGATGGGGATGGTAGCAGG + Intronic
1179653121 21:42827579-42827601 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1179731888 21:43372693-43372715 CGGGGTCTGGGGAGGGAACCAGG + Intergenic
1179746677 21:43447457-43447479 GAGAGGCTGGGGATGGGAGCCGG + Intergenic
1179749049 21:43458110-43458132 CAGAGGCTGAGAAGGGAAGTCGG - Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1180139661 21:45885637-45885659 AAGAGTCAGGGGAGAGAAGCAGG - Intronic
1180800106 22:18627721-18627743 CACAGGCTGGGGCGGGAAGGGGG - Intergenic
1180851339 22:19023286-19023308 CACAGGCTGGGGCGGGAAGGGGG - Intergenic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181221609 22:21367545-21367567 CACAGGCTGGGGCGGGAAGGGGG + Intergenic
1181270970 22:21658187-21658209 CACAGCCTGGGGAGTGGAGCGGG + Intronic
1181717943 22:24748267-24748289 CAGAGTCTGGGAAGGGTAGTGGG + Intronic
1181787892 22:25240541-25240563 AAGAGGCTGGGAAGGGAAGGTGG - Intergenic
1181819627 22:25465577-25465599 CAGAGGCTGGGAAGGGAAGGTGG - Intergenic
1181822916 22:25489532-25489554 CAGAGTCTGGCAAGAGAGGCTGG - Intergenic
1182164539 22:28160049-28160071 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1182455502 22:30447883-30447905 AAGAGGCTGGGGAAGGAACCTGG - Intergenic
1182683912 22:32105732-32105754 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1183008787 22:34927579-34927601 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1183085794 22:35486242-35486264 CAGGGTCTGAGGACGGAAGGAGG - Intergenic
1183242078 22:36665154-36665176 CAGACACTGGGAAGAGAAGCTGG - Intronic
1183270584 22:36860372-36860394 CAGAGGCTGGGGAAGGCTGCAGG + Intergenic
1183270801 22:36861463-36861485 CAGTGTCTGGAGAGGAATGCAGG + Intronic
1183303653 22:37070647-37070669 CACAGTCTGGGGATGGGGGCAGG + Exonic
1183408171 22:37640417-37640439 CAGAGGCTGGGGGTGGGAGCTGG - Intronic
1183472484 22:38017002-38017024 CAGAGGCTGGGGTGGGGGGCTGG - Intronic
1184038213 22:41928537-41928559 CAGGGGCTGGGGAGGGAGCCTGG + Intergenic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184226807 22:43133481-43133503 TAGAGCCTGGGGAAGGAAGGAGG + Exonic
1184254450 22:43279089-43279111 TAGAGTCTGGGGTGGGAAAGAGG + Intronic
1184273292 22:43396840-43396862 CAGGGCCTGGGGCAGGAAGCAGG + Intergenic
1184288591 22:43486260-43486282 CAGTGTCTGGGGAAGGACTCGGG + Intronic
1184690630 22:46115764-46115786 CAAAGTCCAGGGAGGAAAGCCGG + Intergenic
1184742773 22:46438681-46438703 CAGAGGCTGGGGAGGGAGCAGGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1185020423 22:48371409-48371431 CTGAGTCTGGGGAGAGATACAGG - Intergenic
1185034970 22:48469722-48469744 CAGAGGCTGGGAAGGGAAGTCGG - Intergenic
1185065692 22:48630766-48630788 CAGGCGCTGGGGAAGGAAGCTGG + Intronic
1185111489 22:48902514-48902536 CAGGGTCTCGGGAGGGGAGGAGG + Intergenic
1185335536 22:50269593-50269615 CAGAGTCTGGGTGGGGGAGGGGG - Intronic
1185415846 22:50709807-50709829 CAGAGTCTGGGGGAGGATGAAGG + Intergenic
950014458 3:9745820-9745842 AAGAGTCTGGGCCGGGGAGCTGG + Exonic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950086733 3:10264131-10264153 CTGAGTATGAGGAGGGAATCTGG + Intronic
950522678 3:13505918-13505940 CAGGGGCTGGGGAGGGAAAGTGG + Exonic
950827673 3:15842425-15842447 CAGAGGCTGGGAAGGGTAGTTGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951007433 3:17634568-17634590 CAGAGGCTGGGAAGCGTAGCAGG + Intronic
951097992 3:18654027-18654049 CAGAGGCTGGGAAGGGTAGGAGG - Intergenic
951246919 3:20351818-20351840 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
951434498 3:22645900-22645922 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
951494622 3:23312521-23312543 CAGAGGCTGGGAAGGGTAGGGGG - Intronic
951754048 3:26069647-26069669 CAGAGACTGGGAAGGGTAACAGG - Intergenic
951760575 3:26143233-26143255 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
951828525 3:26897306-26897328 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
952132201 3:30377620-30377642 CAGAGGCTGGGATGGGTAGCTGG - Intergenic
952178515 3:30893527-30893549 CAGAGGCTGGGGAGCGGAGAGGG - Intronic
952634696 3:35514104-35514126 CAGAGACTGGGGAGGGTAGGAGG - Intergenic
952743610 3:36757986-36758008 CAGAATCTGGGGAGGCTTGCAGG - Intergenic
953017902 3:39096029-39096051 CAGGGACTAGGGAGGGAGGCAGG + Exonic
953062615 3:39439871-39439893 ATGAATCTGGAGAGGGAAGCAGG - Intergenic
953082416 3:39633101-39633123 CAAATACTGGGGAGGGAAGAGGG + Intergenic
953226418 3:41025687-41025709 CACAGACTGGGGATGGAGGCAGG + Intergenic
953274660 3:41483162-41483184 CAGAGACTGGGAAGGGTAGTGGG - Intronic
953629968 3:44605839-44605861 CAGAAGCTGGGGAGGGTAGTGGG + Intronic
953976933 3:47389046-47389068 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
954080045 3:48208194-48208216 CAGACTCTGCTGAGAGAAGCTGG + Intergenic
954108195 3:48420233-48420255 GAGGGTCTGGGGAGACAAGCGGG + Exonic
954281722 3:49584785-49584807 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
954387239 3:50250570-50250592 CAGGGTCTGGGAAGGACAGCAGG + Intronic
954641876 3:52105470-52105492 CTGCCCCTGGGGAGGGAAGCAGG + Intronic
954817117 3:53291478-53291500 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
954906274 3:54065797-54065819 AGGAGTCTGTGGAGGCAAGCAGG + Intergenic
955366047 3:58311073-58311095 CAGAGGCTGGGAAGGGTAGGAGG - Intronic
955436678 3:58907409-58907431 CAGACCCTGAGCAGGGAAGCAGG + Intronic
955481064 3:59390976-59390998 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
955658679 3:61273020-61273042 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
955932908 3:64075842-64075864 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
956097471 3:65732473-65732495 GAGAGTCTGGGGAAGGATGCTGG - Intronic
956852216 3:73239794-73239816 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
956960926 3:74399826-74399848 CAGAGGCTGGGAAGGGCAGGAGG - Intronic
956990503 3:74757440-74757462 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
957018654 3:75098840-75098862 CAGAGGCTGGGAAGGGACTCAGG - Intergenic
957257524 3:77857306-77857328 CAGAGGCTGGGGAAGGATGGAGG + Intergenic
957323923 3:78667564-78667586 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
957354500 3:79063926-79063948 CAGAGGCTGGGGAGGAGAGATGG + Intronic
957645725 3:82922309-82922331 CAGAGGCTGGGAAGGGCAGGGGG + Intergenic
957818223 3:85331280-85331302 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
958039017 3:88204114-88204136 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
958575191 3:95940487-95940509 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
958608552 3:96393086-96393108 CAGGGTCTGGGAAGGGTAGTTGG - Intergenic
958668660 3:97174034-97174056 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
958685902 3:97393734-97393756 CAGAGTCTGAAGAGGGTAGTGGG - Intronic
958838822 3:99178408-99178430 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
958842455 3:99224132-99224154 CAGAGTCTGGTAAGGGTAGCTGG + Intergenic
958872983 3:99583143-99583165 CAGAGTCTAGGAAGGGTAGTGGG + Intergenic
958920191 3:100096604-100096626 CAGAGTCTGGGAAGAGTAGTAGG + Intronic
959247686 3:103895979-103896001 CAGAGGCTGGAAAGTGAAGCAGG + Intergenic
959280438 3:104330919-104330941 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959491615 3:106996369-106996391 CAGAGACTGAGGAGGAAAGGGGG + Intergenic
959582013 3:107992046-107992068 CAGACTTTGGGGAGTGAAGCTGG + Intergenic
959640026 3:108622220-108622242 CAGAGGCTGGGAAGGGTAGGTGG + Intronic
959981335 3:112521269-112521291 TAGAGTCTGGGAAGGGTAGTGGG - Intergenic
960079866 3:113530035-113530057 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
960235517 3:115277583-115277605 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
960320847 3:116233624-116233646 CAGAGGCTGGAAAGGGAAGTAGG - Intronic
960471249 3:118068352-118068374 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
960506375 3:118499801-118499823 TAGAGTCTGGGGAGGAAGGCTGG - Intergenic
960563012 3:119106360-119106382 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
960641437 3:119827816-119827838 CAGAGGTTGGGAAGGGTAGCGGG + Intronic
960668775 3:120136603-120136625 CAGAGGCTGGGGGGGGGAGTCGG + Intergenic
960870444 3:122244016-122244038 CAGAGGCTGGAGAGGGTAGTCGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
960999985 3:123367666-123367688 CAGATTCAGGGGCGGGAAGAAGG + Intronic
961055637 3:123786494-123786516 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
961175776 3:124834056-124834078 CAGATTCCGGGGGAGGAAGCAGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961475522 3:127143865-127143887 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
961597456 3:128029870-128029892 CAGAGGCTGGGGAAGGAATGGGG - Intergenic
961636485 3:128336124-128336146 CAGCTTCAGGGGAGGGGAGCTGG - Intronic
962139686 3:132776096-132776118 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
962242165 3:133758937-133758959 CAGAGGCTGGAGAGGAAAGTTGG + Intronic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
962468602 3:135684880-135684902 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
962671382 3:137712284-137712306 CAGAGGCTGGGAGGGGTAGCTGG + Intergenic
962698739 3:137976401-137976423 CAGAGCCTGGGAAGGGTAGTGGG - Intergenic
963033678 3:141005214-141005236 TAGAGGCTGGGAAGGGTAGCGGG - Intergenic
963064655 3:141253633-141253655 TAGAGTCTGGCGAGGGAAGTAGG - Intronic
963201050 3:142586083-142586105 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
963411824 3:144937994-144938016 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
963584024 3:147161647-147161669 AAGTGTCAGGGGAGGAAAGCGGG - Intergenic
963858110 3:150277392-150277414 CTGACCCTGGGGAAGGAAGCAGG - Intergenic
964350619 3:155799907-155799929 CAGAACCTGGGAAGGGTAGCTGG + Intronic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964549935 3:157874697-157874719 GAGAGTCTGGGGAGGCTTGCAGG + Intergenic
964758504 3:160111026-160111048 CAGTTACTGGGGAGGGAGGCAGG - Intergenic
965048010 3:163604123-163604145 CAGAGGCTGGAAAGGGAAGTGGG + Intergenic
965075609 3:163971180-163971202 CAGAGTCTGGAAAGGGTAGTGGG - Intergenic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965799841 3:172480421-172480443 CAGAGGCTGGGAAGAGTAGCGGG - Intergenic
965833680 3:172827614-172827636 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
966054062 3:175660661-175660683 CAGAGGCTGGGAAGGGAAAAGGG - Intronic
966133208 3:176667862-176667884 CAGAGGCTGGGAATGGGAGCAGG - Intergenic
966144271 3:176791760-176791782 CAGAGGCTGAGGCGGGAAGATGG + Intergenic
966308250 3:178562394-178562416 AGGATTCTGGGAAGGGAAGCAGG + Intronic
966396152 3:179505419-179505441 CAGAGTCAGAGAAGGGAAGAAGG + Intergenic
966583905 3:181599988-181600010 CAGAGGCTGGGAAGGCAAGTGGG - Intergenic
967098529 3:186196902-186196924 CACAGGCTGGAGAGGGAAGATGG + Intronic
967132477 3:186485302-186485324 CAGAGGCTGGGAAGGGTAGCAGG + Intergenic
967685042 3:192408974-192408996 CGGAGTCTGGGTAGGGGCGCGGG + Exonic
967738423 3:192979205-192979227 CAGACTCTGGGAAGGGTAGGAGG + Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968283375 3:197493814-197493836 CCGAGGCTGGGGAGGTAGGCAGG - Intergenic
968300686 3:197611617-197611639 CAGAGTCTGGAAAGGGTAGTTGG + Intergenic
968448529 4:664294-664316 GAGCGTCTGGGGAGGGCTGCAGG - Intronic
968451314 4:677317-677339 CAGAGTCTGGGGTAGGGACCTGG - Intronic
968655731 4:1777743-1777765 AAGAGGCTGGGGTGGGATGCTGG - Intergenic
968758296 4:2427947-2427969 CAGGGGCTGGAGAGGGGAGCAGG + Intronic
968818997 4:2836169-2836191 CAGAGTCTGGGAGGCGAGGCTGG - Exonic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969699910 4:8762277-8762299 CACTGTATGGGGAGTGAAGCTGG - Intergenic
969728064 4:8937250-8937272 CAGAGAATGGGAAGGGAAGGGGG + Intergenic
970070230 4:12149948-12149970 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
970075230 4:12210810-12210832 CAGAGTCGGGGCAGGGGAGCTGG + Intergenic
970212479 4:13724471-13724493 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
970342701 4:15123117-15123139 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
970922827 4:21415106-21415128 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
971105039 4:23515355-23515377 CAGAGGCTGGGAAGGGTAGCGGG - Intergenic
971218335 4:24682387-24682409 CAGAGTCTGAGAGGGGTAGCAGG - Intergenic
971468459 4:26991414-26991436 CAGAGGCTGGGAAGCGAAGAGGG + Intronic
971829308 4:31670500-31670522 TAGAGGCTGGGAAGGGTAGCGGG - Intergenic
972124984 4:35753323-35753345 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
972225978 4:37012504-37012526 CAGAGGCTGGGAAGGGGAGTAGG + Intergenic
972236651 4:37142362-37142384 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
972314204 4:37910639-37910661 CAGAGACTGGGAAGGGTAGTCGG + Intronic
972469844 4:39393683-39393705 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
972928870 4:44046886-44046908 CAGAGACTGGGAAGGGTAGTAGG + Intergenic
973156732 4:46964254-46964276 CAGAGACTGGGAAGGGTAGCGGG + Intronic
973275579 4:48303397-48303419 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
973625371 4:52766363-52766385 CAGAGTCTGGGAAGAGTAGTGGG - Intergenic
973724847 4:53764689-53764711 CAGAGTTTGGGCAGGGATGGAGG - Intronic
973960588 4:56105971-56105993 CAGAGCTTGGGGATGGAAGAAGG - Intergenic
973967118 4:56174443-56174465 CAGAGGCTAAGAAGGGAAGCAGG - Intronic
974278986 4:59765480-59765502 AAGAGTTTGAGGAGGGAAGGTGG - Intergenic
974352439 4:60766872-60766894 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975080026 4:70266037-70266059 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
975276810 4:72512106-72512128 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
975336072 4:73176556-73176578 CAGAGGCTGGGGAGGGTAGTTGG + Intronic
975507223 4:75150821-75150843 CAGAGGCTGGGAAGGAAAGAAGG - Intergenic
975649302 4:76576491-76576513 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
975669539 4:76767084-76767106 CAGGGTCTGGGAAGGAAAGATGG + Intronic
975808007 4:78133364-78133386 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
975931022 4:79522735-79522757 CAGAGCCTGGAGAGGGGAGAAGG + Intergenic
975977307 4:80113992-80114014 CAGAGGGTGGGAAGGGTAGCAGG - Intronic
976038188 4:80849705-80849727 CAGAGGCTAGGGAGGGTAGAGGG + Intronic
976151427 4:82096356-82096378 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
976340241 4:83939184-83939206 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
976902653 4:90197773-90197795 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
976999263 4:91475797-91475819 CAGAGGCTGGGAAGAGTAGCAGG - Intronic
977140069 4:93359565-93359587 CAGAGGCTGGGAAGAGTAGCGGG - Intronic
977364396 4:96049015-96049037 CAGAGACTGGGGAGAAAAGCGGG - Intergenic
977419603 4:96781537-96781559 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
977458110 4:97288707-97288729 CAGAGTCTGGGAAGGGTTGTAGG - Intronic
977496947 4:97788223-97788245 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
977796584 4:101173037-101173059 AGGAGTCTGAGGAGGGAAGTTGG - Intronic
977873102 4:102117000-102117022 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978212240 4:106151358-106151380 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
978351223 4:107822939-107822961 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
978743542 4:112165748-112165770 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
978816003 4:112906428-112906450 CAGCGTCTGGATAGGGAAGTTGG + Intronic
978933774 4:114350748-114350770 CAGAGGCTGGGAAGGATAGCGGG - Intergenic
979174351 4:117643892-117643914 CAGAGTCTGGGAAGGGTATTGGG - Intergenic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979371486 4:119893484-119893506 CAGAGCCTGGGAAGAGAAGTGGG - Intergenic
979402216 4:120262429-120262451 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
979445969 4:120812024-120812046 CAGAGGCTGGGAAGGGTAGCGGG - Intronic
979980172 4:127245321-127245343 CAGAGTCTGGGAAAGGAAGAGGG + Intergenic
980089755 4:128430506-128430528 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
981045055 4:140257045-140257067 TAGAGTCTGGGGAGGGGAGGTGG - Intergenic
981173628 4:141654277-141654299 CAGATTCCTGGAAGGGAAGCAGG + Intronic
981232417 4:142372267-142372289 CAGAGTCTGGGAAGGGGAGATGG + Intronic
981342961 4:143643647-143643669 CAGAGACTGGGGAGGGCAGTTGG + Intronic
982064663 4:151643592-151643614 CAGAGGCTGGGAAGGGAAGGGGG - Intronic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
982375545 4:154686474-154686496 CAGAGCCTGGGAAGGGTAGTTGG - Intronic
982927488 4:161357169-161357191 CAGAGGCTGGGAAGGGGAGAAGG + Intergenic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983173317 4:164559585-164559607 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
983216681 4:165008425-165008447 CAGACTCAGGGCAGTGAAGCAGG - Intergenic
983289072 4:165778417-165778439 CAGAGGCTGGGAAGGGAATGAGG - Intergenic
983348380 4:166556411-166556433 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
983477104 4:168226873-168226895 CAGAGGCTGGGAAGGGTAGCTGG + Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983586594 4:169362305-169362327 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
983807542 4:172013868-172013890 CAGAGTCTGGGAAGGGTAGTGGG - Intronic
983943007 4:173555890-173555912 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
984219289 4:176954066-176954088 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
984453111 4:179929054-179929076 CAGAGGCTGGGAAGGGCAGTGGG - Intergenic
984496050 4:180498360-180498382 CAGAGGCTGGGAAGCGTAGCAGG - Intergenic
984634447 4:182095530-182095552 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
984950755 4:185005870-185005892 CAGAGGCTGGGAAGGGCAGTAGG - Intergenic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985230086 4:187806296-187806318 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
985311462 4:188604336-188604358 CAGAGCCTGGGTGGGGAAGTGGG - Intergenic
985485025 5:143589-143611 CAGAGTCTGGCCATGGAAGCTGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986145244 5:5071657-5071679 CAGAGCCTGGGGTGAGAAGTAGG - Intergenic
986386623 5:7240491-7240513 CAGAGGCTGGGAAGGGGAGGAGG - Intergenic
986411022 5:7479744-7479766 CAGAGGCTGGGAAGGGTAACTGG - Intronic
986564617 5:9099896-9099918 CAGAGTGTCGAGAGTGAAGCTGG - Intronic
986810817 5:11357519-11357541 CAGAGACTAGGGAGGGGAGGAGG + Intronic
987267410 5:16271276-16271298 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
987481417 5:18463439-18463461 CAGAGGCTAGGAAGGGTAGCGGG + Intergenic
987524770 5:19032998-19033020 CAGAGACTGGGGAGGGGAGGTGG + Intergenic
987616776 5:20284092-20284114 CAGGGGCTGGGGATGGTAGCGGG + Intronic
987689568 5:21249795-21249817 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
987876855 5:23690748-23690770 CCGAGTGTTGGGAGGGAAACAGG + Intergenic
987952792 5:24697527-24697549 CAGAGTCTGGGAAGGGTAGTAGG - Intergenic
988324982 5:29753130-29753152 CAGAGGCTGGGGAGGGAGTGAGG + Intergenic
988494664 5:31734705-31734727 CAAACTCTGGGGAGGGGAGAGGG - Intronic
989111608 5:37912235-37912257 CAGAGGCTGGGCAGGGTAGTTGG + Intergenic
989178553 5:38554588-38554610 AGTACTCTGGGGAGGGAAGCGGG + Intronic
989421387 5:41242984-41243006 CAGAGGCTGGGGATGGGAGGAGG + Intronic
989553750 5:42766750-42766772 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
989658872 5:43776712-43776734 CAGAGGCTGGGAAGAGTAGCTGG - Intergenic
989735397 5:44697288-44697310 CAGAGTGGGGGGAAGTAAGCAGG - Intergenic
990074080 5:51820960-51820982 CAGAAAGTGGGGAGGGATGCAGG - Intergenic
990079131 5:51890975-51890997 CAGAGACTGGGGAAGGTAGTGGG + Intergenic
990213564 5:53506978-53507000 CAGAGTCTGGGAAGGATAGTCGG - Intergenic
990257564 5:53987031-53987053 CAGAGACTGAGGATGGAAACTGG + Intronic
990842011 5:60092280-60092302 CAGACATTGGGAAGGGAAGCAGG + Intronic
990923208 5:60991452-60991474 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
991310036 5:65228698-65228720 CAAAGGCTGGGGAGGGTGGCAGG - Intronic
991380359 5:66016559-66016581 CAGAGGCTGAGGAGGGTAGTGGG - Intronic
991600643 5:68348667-68348689 CAGAGGCTGGGCAGGGCAGCAGG - Intergenic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
991922697 5:71672493-71672515 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
991959334 5:72028395-72028417 CAGAGTCTGAGGTGGGAGGGAGG - Intergenic
992091776 5:73323939-73323961 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
992248584 5:74854605-74854627 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
992453696 5:76896184-76896206 TAGAGACTGGGAAGGGTAGCAGG - Intronic
992587793 5:78259361-78259383 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
992725056 5:79597889-79597911 AAGAGTCTGGAAAGGGAAGTGGG - Intergenic
992805557 5:80333774-80333796 AAGAGGCTGAGGTGGGAAGCAGG - Intergenic
992850517 5:80802720-80802742 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
993094999 5:83471518-83471540 GAGTGCCTGGGGAGGGAGGCAGG + Exonic
993203755 5:84850638-84850660 TAGAGGCTGGGAAGGGAAGGGGG + Intergenic
993315064 5:86393301-86393323 CAGAGTCAGGGAAGGGTAGCAGG + Intergenic
993356434 5:86914434-86914456 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
993429105 5:87809925-87809947 CAGAGGCTGGGAAGGGGAGAAGG - Intergenic
993507876 5:88733327-88733349 CAGAGGCTCTGGAGGGATGCAGG + Intronic
993768169 5:91889208-91889230 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
994446910 5:99887631-99887653 TAGAAGCTGGGGAGGGTAGCTGG - Intergenic
994974514 5:106784625-106784647 CAGAGTCTGGGAAGGGTAGTTGG + Intergenic
995154067 5:108889541-108889563 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
995512373 5:112921996-112922018 CAGCTGCTGGGGAAGGAAGCAGG - Intronic
995559879 5:113369193-113369215 CAACCTCTGGGGAGGGAAGAGGG - Intronic
995785408 5:115822504-115822526 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
995826803 5:116309146-116309168 CAGAGACTAGGAAGGGTAGCAGG - Intronic
996102886 5:119463009-119463031 TAGAGGCTGGGAAGGGTAGCAGG - Intronic
996162793 5:120186692-120186714 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
996483383 5:124001225-124001247 CAGAGGGTCGGGAGGGGAGCTGG + Intergenic
996571402 5:124935985-124936007 CAGCCTCTGGGGAGGGAAGGGGG - Intergenic
996883927 5:128333325-128333347 CTGAATCTGGGCAGGGAAGAAGG - Intronic
997002577 5:129779764-129779786 CAGAGGCTGAGAAGGGAAGTGGG + Intergenic
997060461 5:130495357-130495379 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
997294580 5:132761680-132761702 CAGAGTCAGGGTAGGCACGCAGG + Intronic
997379507 5:133425567-133425589 CAGAGTCTTGGGAGGTCAGTTGG - Intronic
997417069 5:133737254-133737276 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
997605303 5:135171100-135171122 CACAGCCTGGGGAGTGAAGCTGG - Intronic
997887527 5:137643885-137643907 CAGAGGCTGGGGAAGGGAGGAGG - Intronic
998159943 5:139807783-139807805 AAGAGCCTGGGGAGGGAGGCGGG - Intronic
998167693 5:139853762-139853784 CAGAGGCTGGGAAAGGAAGTGGG + Intronic
998181955 5:139952211-139952233 CAGAGGCTGGGCAGAGGAGCAGG - Intronic
998350353 5:141496348-141496370 CAGAGCCCAGGGAGAGAAGCAGG + Intronic
998584738 5:143415334-143415356 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
998662110 5:144250389-144250411 GTGAGTATGGGGAGGGAAGTGGG + Intronic
998698035 5:144663276-144663298 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
998735571 5:145136096-145136118 CAGAGACTGGAGAGGGTAGAGGG - Intergenic
998910069 5:146949961-146949983 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
999232394 5:150069488-150069510 CAGAGGCTGATGAGGGAGGCAGG - Intronic
999247795 5:150164545-150164567 CTGAGTCTGGGGAGGAAGACAGG - Intergenic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
999715925 5:154359833-154359855 AAGAATCTTGGGAGGGAAGATGG - Intronic
1000126925 5:158254530-158254552 CTGAGACTGTGGAGAGAAGCTGG + Intergenic
1000393525 5:160749425-160749447 CACAGTATGAGGAGGGCAGCTGG - Intronic
1000538878 5:162513819-162513841 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1000555261 5:162718072-162718094 AAGAGTTTAGGGAGGGAGGCTGG - Intergenic
1001169590 5:169406316-169406338 CAGAGTCTGGGAAGGGTACTGGG - Intergenic
1001341142 5:170846622-170846644 CAGAGTCTGGGAAAGGAAGTTGG - Intergenic
1001523132 5:172409486-172409508 TAGAGGCTGGGGAGGGTAGGGGG - Intronic
1001571218 5:172731939-172731961 CACAGTGGGGGGAGGGTAGCAGG + Intergenic
1001581787 5:172803724-172803746 CAGAGGCTGGGAAGAGAAGTGGG - Intergenic
1001599941 5:172922367-172922389 CGGAGTCTGGGGAGCACAGCAGG + Intronic
1001667397 5:173444692-173444714 TAGAGGCTGGGGTGGGGAGCAGG + Intergenic
1001814095 5:174653389-174653411 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1001937992 5:175719766-175719788 CAGATCCTGGGGAGGCAAGGTGG - Intergenic
1002194447 5:177494631-177494653 CAGAGCGTGGGGAGGGCAGCAGG + Intronic
1002200338 5:177524399-177524421 CTGAGGCTGGAGAGGGGAGCCGG - Exonic
1002399651 5:178984551-178984573 CTGAGGCTGGGGAGGAGAGCTGG + Intronic
1002412343 5:179091948-179091970 CAGATGCTGGGAAGGGAAGTGGG - Intergenic
1002603544 5:180369002-180369024 CAGAGTCAGGGGACAGAAGCTGG - Intergenic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1003010880 6:2426547-2426569 CGGAGGCTGGGAAGGGAAGCGGG - Intergenic
1003147816 6:3523541-3523563 CAGAGTCTGAGGAGGAAGGGAGG - Intergenic
1003219755 6:4148747-4148769 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1003669099 6:8139296-8139318 GAGAGTCTGTTGAGGGAAGCAGG + Intergenic
1003727496 6:8781823-8781845 CAGAGGCTGGGGAGGGGATGAGG - Intergenic
1003835090 6:10062830-10062852 GAGAGTCTGGGAGGAGAAGCAGG + Intronic
1003875195 6:10429941-10429963 CAGAGACAGGGCGGGGAAGCAGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1003982204 6:11400611-11400633 CAGAGGCTGGGAAGGGTAGGAGG + Intergenic
1004201860 6:13555930-13555952 CAGAGTGGGGGGAGAGGAGCTGG + Intergenic
1004241710 6:13928896-13928918 GGGAGTCTGGGGCAGGAAGCTGG + Intronic
1004793744 6:19057954-19057976 CAGAGTCTGGGAAGAGTAGTGGG + Intergenic
1005178562 6:23076492-23076514 CAGATTCTGGGAAGGGAAGAGGG + Intergenic
1005265218 6:24105262-24105284 GAGAGTATGTGGAGGGAAGTGGG - Intergenic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1005970336 6:30756023-30756045 AGGAGTCTGGGCAGGGAGGCAGG - Intergenic
1006360535 6:33584693-33584715 CACAGTCAGGTGAGGGAGGCAGG - Intergenic
1006588716 6:35138572-35138594 CAGAGGCTGGGAAGGGTAGTTGG + Intronic
1006662452 6:35658964-35658986 CAGAGGCTGAGGTGGGAAGACGG + Intronic
1007071864 6:39043818-39043840 CAGGGTCTGAGAAGAGAAGCAGG + Intergenic
1007169054 6:39849748-39849770 CAGAGGCTTGGGGTGGAAGCAGG + Intronic
1007584137 6:42978626-42978648 CAGAGTCTGGGGACAGCAGTCGG - Exonic
1008836461 6:55837808-55837830 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1008841102 6:55905377-55905399 CAGAGTCTAGGAAGGGTAGCAGG + Intergenic
1009329214 6:62394985-62395007 CAGAGGCTGGGAAGGGTAGAAGG - Intergenic
1009387516 6:63104009-63104031 CAGAGGCTGGGAACGGTAGCAGG - Intergenic
1009569716 6:65368780-65368802 CTGACTCTTGGGAGGGAAGTTGG - Intronic
1009624906 6:66126706-66126728 CAGAGACGGGGGATGGTAGCAGG + Intergenic
1009789200 6:68379226-68379248 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1009803714 6:68574917-68574939 CAGAGACTGGGGATGGTAGTAGG + Intergenic
1009824125 6:68844960-68844982 CAGAGTCTGGGAAGGGTAGTGGG + Intronic
1010041264 6:71387585-71387607 CAGAGTTTGAGGAGAGAAACTGG + Intergenic
1010130071 6:72481620-72481642 CAGAGGCTGGGGAGAGTAGTTGG + Intergenic
1010187604 6:73161295-73161317 CAGAGGCTGGGAAGAGAAGTTGG + Intronic
1010299047 6:74237401-74237423 CAGAGACTGGGAAGGGTAGCAGG - Intergenic
1010328504 6:74593379-74593401 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1010529422 6:76948904-76948926 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1010611295 6:77956780-77956802 CAGAGGCTAGGGAGGGTAGTGGG + Intergenic
1010661625 6:78578079-78578101 CAAAGTCTTTGGAGGGAAGAGGG + Intergenic
1011153645 6:84303929-84303951 CAGAGGCTAGGGTGGGAAGTTGG + Intergenic
1011285103 6:85714838-85714860 CAGAGCCTGGGAAGGGTAGTGGG - Intergenic
1011434167 6:87320003-87320025 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1011901920 6:92309020-92309042 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1012611156 6:101222634-101222656 CATAGGATGGGAAGGGAAGCAGG - Intergenic
1012620174 6:101334596-101334618 CAGAGTCTGGGGAAGGTAATGGG - Intergenic
1012712418 6:102624440-102624462 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1012800902 6:103826447-103826469 CAGAGTCTGGAAAGGGTAGTAGG + Intergenic
1012892830 6:104916468-104916490 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1013251620 6:108340048-108340070 CAGAGACTGGGAAGGGTAGTGGG - Intronic
1013257038 6:108397614-108397636 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1013454034 6:110313820-110313842 GAGAGACTAGGGAGGGAAGCTGG - Intronic
1013643618 6:112113004-112113026 TAGAGGCTGGGAAGGGAAGGGGG + Intronic
1014051002 6:116954290-116954312 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1014186330 6:118438507-118438529 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1014436589 6:121427466-121427488 CAGAGGCTTGGGAGGGAAAGAGG + Intergenic
1014693029 6:124585300-124585322 CAGAGGCTGGGAAAGGTAGCTGG + Intronic
1014840320 6:126211925-126211947 CAGAGGCTGGGAAGGGTAGGGGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1014864746 6:126514914-126514936 CGGAGGCTGGGAAGGGAAGTAGG - Intergenic
1015194023 6:130505601-130505623 CAGAGTCTGTGAAGGGTAGTAGG + Intergenic
1015858052 6:137646574-137646596 CAGAGGCTGGGAAGGGGAGGAGG - Intergenic
1016252019 6:142054992-142055014 CAGAGGCTGGGAAGGGTAGCAGG + Intergenic
1016497615 6:144682149-144682171 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1016623197 6:146135929-146135951 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1016748610 6:147608633-147608655 CAGAGGCTGGGAAGGGTAGTAGG + Intronic
1016915636 6:149241971-149241993 CAGAGCCTGGGGAAGGCAGTGGG - Intronic
1017061035 6:150485159-150485181 TAGAGTCTGGGAAGGGAAGCAGG - Intergenic
1017105141 6:150880260-150880282 CAGAGGCTGGAGAGGGATGGGGG - Intronic
1017296250 6:152798129-152798151 CAGAGGCTGGGAAGGGAAATGGG + Intergenic
1017347998 6:153406783-153406805 CAGAAGCTGGGTAGGGAAACAGG - Intergenic
1017600049 6:156070437-156070459 TAGAGTCTGCAGAGGAAAGCAGG - Intergenic
1017604959 6:156123948-156123970 CACAGAATGGGGAGAGAAGCAGG + Intergenic
1018334129 6:162766213-162766235 CAGAGGCTGGGCAGGGAAAGAGG - Intronic
1018798289 6:167203780-167203802 CTGAGTCTGGGGAAGGAATCAGG - Intergenic
1018814423 6:167320396-167320418 CTGAGTCTGGGGAAGGAATCAGG + Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1018916715 6:168136722-168136744 CAGAGTGTGGGGAGGGTTGTAGG + Intergenic
1019016399 6:168883561-168883583 CAGGGACTCAGGAGGGAAGCTGG + Intergenic
1019083509 6:169452971-169452993 GGGAGGCTGGGGAGGGAGGCCGG - Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019278402 7:187937-187959 CAGAGGCCAGGGAGGGGAGCGGG - Intergenic
1019379444 7:713208-713230 GAGCCTCTGGGGAGGGAAGATGG - Intronic
1019402628 7:864979-865001 CAGAGACTGGGAAGGGGAGTTGG - Intronic
1019686511 7:2384857-2384879 CAAAGTCAGGGCAGGGGAGCAGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020033463 7:4949330-4949352 CAGAGGCTGGGAAGGGGAGTGGG - Intronic
1020280566 7:6648039-6648061 CAGGGCCTGGGGACAGAAGCTGG + Intronic
1020518693 7:9158454-9158476 CAGAGTCTGGGAAGTGTAGCGGG + Intergenic
1020612938 7:10423434-10423456 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1020676760 7:11192836-11192858 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1020808273 7:12818329-12818351 CAAATTATGGGGAGGGAAGAAGG - Intergenic
1021194177 7:17656350-17656372 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1021316271 7:19151233-19151255 CAGAGTCTTGGAAGGGTAGTGGG - Intergenic
1021843274 7:24740272-24740294 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022209181 7:28191956-28191978 CAGAGGCTGGGGAGGAAAAAGGG + Intergenic
1022514875 7:30969162-30969184 CAGAGTCAGGTGAGGGGTGCTGG + Exonic
1022599293 7:31741829-31741851 AAGATACTGGGGAGGGAGGCAGG + Intergenic
1022758441 7:33320238-33320260 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1022972600 7:35531206-35531228 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1023311640 7:38893305-38893327 GTGAGTCTGGGCAGCGAAGCTGG - Intronic
1023449842 7:40271834-40271856 CAGAGGCTGGGAAGGGTAGGGGG - Intronic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023842674 7:44105883-44105905 CAGAGTCTGGGAGAGGGAGCAGG - Intronic
1024047993 7:45598030-45598052 CAGGGTCTGGGCAGAGAAGAAGG + Intronic
1024092277 7:45953577-45953599 CAACATCTGGGGAGGAAAGCTGG + Intergenic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1024368575 7:48552967-48552989 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
1024595659 7:50933945-50933967 CATAGTATGAGGAGGCAAGCAGG - Intergenic
1024639839 7:51319444-51319466 CAGAGCCTGGGGGGGCAGGCGGG + Intergenic
1024874989 7:54011577-54011599 CAGAGGCTGGGAAGGGTAACAGG + Intergenic
1024961772 7:54984133-54984155 CAGAGGCTAGGAAGGGTAGCAGG - Intergenic
1024961868 7:54985080-54985102 CAGAGTCTGGGAAGGGTACATGG - Intergenic
1025093999 7:56083842-56083864 CACAGTCTGGGGAGAGGAGCCGG + Intronic
1025766180 7:64453649-64453671 CAGAGTCTGGGGAGGGGTCTGGG - Intergenic
1025826188 7:65012807-65012829 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1025913746 7:65849273-65849295 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1025975810 7:66368773-66368795 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1026072919 7:67138625-67138647 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1026148716 7:67770541-67770563 CAGAGGCTGGGTAGGGTAGCAGG + Intergenic
1026531050 7:71197594-71197616 CAGAGGCTGGGAAGGGGAGTGGG - Intronic
1026583743 7:71638922-71638944 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1026615940 7:71904530-71904552 CAGAGACTGGGGTGGGTAGTGGG + Intronic
1026663495 7:72322653-72322675 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1026703961 7:72673591-72673613 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027404721 7:77847856-77847878 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
1027430380 7:78106010-78106032 CGGAGACTGGGAAGTGAAGCAGG - Intronic
1027443893 7:78249691-78249713 CAGTGGCTGGGGAGGGTAGTGGG + Intronic
1027872575 7:83728541-83728563 CAGAGACTGGGGAGAAAAGAAGG - Intergenic
1028512357 7:91639238-91639260 CAGAGGCTGGGAAGAGAAGTGGG + Intergenic
1028735691 7:94209855-94209877 TAGAGGCTGGGGAGAGCAGCAGG - Intergenic
1028760175 7:94487324-94487346 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1028973271 7:96883275-96883297 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1029088392 7:98029241-98029263 CAGAGGCTGGGAAGGGTAGGTGG - Intergenic
1029166051 7:98591864-98591886 GAAAGTGTGGGGAGGGAGGCGGG - Intergenic
1029330879 7:99854158-99854180 CAGACTCTGGGAAGGGTAGTGGG - Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029512839 7:101007400-101007422 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
1029594931 7:101532662-101532684 CAGAGTCTGGGGAAGGAGTTGGG - Intronic
1030154945 7:106445434-106445456 CAGAGTTTGGGAAGGGGAGTAGG - Intergenic
1030154963 7:106445506-106445528 CAGAGTTTGGGAAGGGGAGTAGG - Intergenic
1030759731 7:113335602-113335624 CAGAGACTAGGGAGAAAAGCGGG + Intergenic
1031078416 7:117234737-117234759 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1031188941 7:118521342-118521364 TAGAGTGTGGGAAGGGAAGTGGG - Intergenic
1031306732 7:120137360-120137382 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1031894648 7:127335288-127335310 CAGAGGCTGGGGAAGGAATAGGG + Intergenic
1032117665 7:129130292-129130314 CAGCCTCTGGGGAAGGAAACTGG - Intergenic
1032350607 7:131159554-131159576 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
1032941268 7:136795401-136795423 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1033081870 7:138306334-138306356 CCTACTCTGGGGAGGGAAGGGGG - Intergenic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033311161 7:140263007-140263029 CAGAAGCTGGGGAGGGTTGCTGG - Intergenic
1033386182 7:140878580-140878602 CAGAGTCTGGGAAGAAAAGGAGG + Intronic
1033641063 7:143263611-143263633 CAGTGTCTGGGGAGTGAGGGCGG + Intronic
1033702158 7:143850431-143850453 CAGAGGCTTGGGAGGGTAGTGGG + Intergenic
1033722065 7:144071168-144071190 TAGAGGCTGGGAAGGGTAGCAGG - Intergenic
1034285478 7:149880778-149880800 GTGGGTCTGGGGAGGGGAGCAGG + Intergenic
1034490229 7:151389322-151389344 CAGAGGCTGGGGAGGAAAAGAGG - Intronic
1034518180 7:151598287-151598309 CAGAGGCTGGGGAGGGAATGGGG + Intronic
1034532558 7:151705725-151705747 CAGAGCCTGGAGAGTTAAGCAGG - Intronic
1034687227 7:152983347-152983369 TAGAGGCTGGGGAGGGTAGGGGG + Intergenic
1034801981 7:154060597-154060619 CAGAGCCAGGGGGGGGAAGAGGG - Intronic
1035074451 7:156169011-156169033 CAGTGTGTGGGGTGGGATGCTGG + Intergenic
1035128576 7:156629827-156629849 CAGAGGCTGTGCAGGGCAGCAGG - Intergenic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035349404 7:158235581-158235603 CAGAGGATGGGAAGGGGAGCTGG + Intronic
1035358637 7:158295395-158295417 CAGTGTCTGGGCAGGCAGGCAGG - Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035837419 8:2769684-2769706 CTGAGGCTGGGAAGGCAAGCTGG + Intergenic
1035910046 8:3556285-3556307 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1035911584 8:3572281-3572303 CAGAGCCTGGGGCAGAAAGCAGG + Intronic
1036200767 8:6769822-6769844 CAGAGTCTAGGAAGGGTAGATGG - Intergenic
1036560788 8:9898916-9898938 CGGAGTCGGGGGCAGGAAGCGGG - Intergenic
1036634161 8:10537449-10537471 CAGAGGCTGGGGAGGAAAGCAGG + Intronic
1036707500 8:11056181-11056203 CCCAGTCTGGGGAGCGCAGCAGG - Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1036943974 8:13077098-13077120 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1037084377 8:14829186-14829208 CAGAGTGTTGGGGTGGAAGCAGG - Intronic
1037277026 8:17191462-17191484 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
1037296117 8:17402408-17402430 CAGAGGCTGGGGAAGGTAGTGGG - Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1037487942 8:19366457-19366479 CAGAGGCTGGGGAGAGTAGGGGG - Intronic
1037667322 8:20981209-20981231 CAACCTCTGGGGAGGGAAGAAGG + Intergenic
1037697620 8:21239548-21239570 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1037787813 8:21912830-21912852 TCCAGTCTGGGGAGGAAAGCGGG + Intronic
1038153961 8:24969851-24969873 CAGAGGCTGGGAAGGGTAGAGGG - Intergenic
1038461358 8:27720062-27720084 CAGAGGATGGGGAGGGATGAGGG + Intergenic
1038677419 8:29635895-29635917 CACATTCTGGGGAGGGGAGTTGG + Intergenic
1038860765 8:31387067-31387089 TAGAGGCTGGGAAGGGTAGCAGG + Intergenic
1038892899 8:31747001-31747023 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1039610654 8:38916414-38916436 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039640370 8:39213836-39213858 CAGAGGCTGGGAAGGGTAGTTGG - Intronic
1039650590 8:39336988-39337010 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1039660899 8:39463625-39463647 CAGAGCCTGGGAAGGGTAGTGGG + Intergenic
1039675039 8:39653971-39653993 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1040048633 8:42989735-42989757 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1040416592 8:47201173-47201195 CAGACTCAGGGGAGGGGAGCAGG + Intergenic
1040433132 8:47363561-47363583 CAGAGCCTGGGGCGGGAAGAAGG - Intronic
1040628489 8:49179965-49179987 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1040671362 8:49694940-49694962 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1040867309 8:52061343-52061365 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1040954451 8:52965435-52965457 AAGAGTTTGGGGAGCAAAGCAGG - Intergenic
1041487040 8:58390876-58390898 CAGAGGCTGGGAAGAGCAGCAGG + Intergenic
1041626733 8:60037790-60037812 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041893638 8:62899575-62899597 CAGAGGCTGGGAAGGGTAGCGGG + Intronic
1042484396 8:69334671-69334693 CAGAGGATGGGAAGGGTAGCAGG + Intergenic
1042619293 8:70687107-70687129 CAGAGCCTGGGAAGCGTAGCAGG - Intronic
1042774412 8:72413986-72414008 TAGAGTGTGGGCAGGGAAGATGG + Intergenic
1042845822 8:73168568-73168590 CGAAGTCAGGGGAGGGAAGTGGG + Intergenic
1042983556 8:74557641-74557663 CAGAGGCTGGGAAGGAAAGAAGG + Intergenic
1043282003 8:78479908-78479930 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1043321053 8:78987453-78987475 CAGGGGCTGGGGTGGGGAGCTGG + Intergenic
1044006841 8:86947907-86947929 CAGAGTCTGGGAAGGGTAGCAGG - Intronic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044122650 8:88416380-88416402 CAGAGTCAGAGGAGGGAATGTGG + Intergenic
1044192516 8:89335723-89335745 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1044294697 8:90513875-90513897 CAGAGTGTGGGGTGGGAGGAGGG + Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1044505331 8:93010098-93010120 CAGAGACTGGGGAGAGTAGGAGG + Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044526394 8:93256522-93256544 CAGAGTCCGAGAAGGGAAGGAGG + Intergenic
1044582887 8:93839839-93839861 CAGAGGCTGGGAAGGGGAGTGGG - Intergenic
1044623493 8:94213835-94213857 CAGAGTATTGGCAAGGAAGCCGG - Intronic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1044990323 8:97789866-97789888 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1046022585 8:108683756-108683778 CAGAGACTGGGAAGGGTAGAGGG - Intronic
1046116502 8:109791005-109791027 CAGAGGCTGGGGAGGGTAGTAGG + Intergenic
1046368831 8:113272840-113272862 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046462917 8:114566530-114566552 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1047072818 8:121366025-121366047 CAGAGGCTGGGGAGGGGAGTGGG + Intergenic
1047076552 8:121410851-121410873 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047183860 8:122614496-122614518 CTGATACTGGGGAGGGTAGCAGG - Intergenic
1047775104 8:128063701-128063723 CAGAGTCTGGGGAGGGGGTTGGG + Intergenic
1048060368 8:130913339-130913361 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1048132072 8:131708828-131708850 CAGAGGCTGGGAAGGGGAGTAGG + Intergenic
1048192952 8:132307003-132307025 CAGAGTTTGGGGGTGAAAGCTGG + Intronic
1048299152 8:133238846-133238868 CAGAGTCCGGGGGCGGCAGCTGG + Exonic
1049242415 8:141544770-141544792 CAGGGCCTGGGTAGGGAGGCAGG - Intergenic
1049305135 8:141898692-141898714 CAGAGTCATGGGTGGGAAGCTGG + Intergenic
1049390066 8:142363223-142363245 CAGGGCCTGGTGAGGAAAGCGGG + Intronic
1049408743 8:142463185-142463207 CAGGGCCTGGGGAGGGATGGAGG - Intronic
1049428585 8:142548963-142548985 CAGAGTCTGCTGAGGGGAACAGG - Intergenic
1049479676 8:142815891-142815913 CAGAGACTGGGGCGGGGAGGTGG + Intergenic
1050006961 9:1141734-1141756 CTGAGGCTGGGCATGGAAGCTGG + Intergenic
1050350256 9:4734388-4734410 CAGAGTGTGGGCATGGGAGCAGG - Intronic
1050491344 9:6191277-6191299 CAGGGTCTGGGGTGGGAAGAAGG - Intergenic
1050518849 9:6476033-6476055 CAGAGTCTGGGAAGGGAAGTGGG - Intronic
1050522369 9:6514514-6514536 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1050572516 9:6956090-6956112 CAGAGGCTGAGGAGGGTAGTTGG + Intronic
1050866040 9:10500699-10500721 AAGAGTCTGGGAAGGGTAGTTGG - Intronic
1050882209 9:10716310-10716332 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1051047758 9:12895537-12895559 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1051230056 9:14946691-14946713 CAGAGTCTAGGAAGGGTAGTGGG + Intergenic
1051465720 9:17375262-17375284 CAGAGCCTGGGAAGGGTAGTTGG + Intronic
1051573556 9:18587639-18587661 CAGAGGCTGGTAAGGGAAGCAGG - Intronic
1051594989 9:18816142-18816164 CAGAGACTGGGGAAGGGAGCGGG - Intronic
1051903636 9:22069824-22069846 CAGAGACTGGGGAAGCAAGAAGG - Intergenic
1052258146 9:26483693-26483715 CAGAGCCTGGGAAGGGTAGTGGG - Intergenic
1052450368 9:28622301-28622323 CAGAGGCTGGGGAGGGTATTGGG - Intronic
1052539329 9:29787703-29787725 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1052546384 9:29886022-29886044 CAGAGGCTGAGGTGGGAAGATGG + Intergenic
1052666903 9:31507112-31507134 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1052771315 9:32693533-32693555 CAGAGGCTGGGAAGGGTAGCAGG + Intergenic
1052958631 9:34274989-34275011 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1053026315 9:34731447-34731469 CAGAGGCTGGGAAAGGTAGCGGG - Intergenic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053315994 9:37052328-37052350 CAGAGACTGGTCAGGGAGGCTGG + Intergenic
1054892801 9:70270438-70270460 CATCCTCTGGGAAGGGAAGCAGG - Intronic
1054921140 9:70543492-70543514 CAGAGGCTGGGAAGGGTAGTCGG - Intronic
1055395785 9:75873660-75873682 CAGAGGCTGGGAAGGGTAGTCGG + Intergenic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1055668327 9:78574328-78574350 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1055790681 9:79919923-79919945 CAGAGGCTGGGAAGGGTGGCAGG - Intergenic
1055885695 9:81060984-81061006 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1056067973 9:82956666-82956688 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1056087735 9:83168993-83169015 CAGAGGCTAGGAAGGGCAGCAGG - Intergenic
1056171551 9:83990162-83990184 CAGAGGCTGGGAAGGGTAGGGGG + Intronic
1056175724 9:84033425-84033447 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1056183878 9:84112395-84112417 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1056187408 9:84149135-84149157 CAGGGCCTGGGAAGGGTAGCAGG - Intergenic
1056210944 9:84364668-84364690 CAGAGGCTGGGGAGGGTAGTGGG - Intergenic
1056618267 9:88187424-88187446 TAGAGTCTGGAGAGGGAGGCTGG - Intergenic
1056773778 9:89497609-89497631 CAGGGACTGGGGAGGCAACCGGG + Intronic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1056832725 9:89929822-89929844 CAGGGGCTGGGGAAGGGAGCAGG + Intergenic
1056834519 9:89943653-89943675 CAATGTCTGGGGAGGGAAAGAGG - Intergenic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057327372 9:94077757-94077779 CAGCTTCTGGGGAGGGGAGAGGG - Intronic
1057346579 9:94256820-94256842 CAGGGTCTTAGGATGGAAGCAGG + Intergenic
1057536480 9:95913662-95913684 CAGGGACTGGAGATGGAAGCAGG - Intronic
1057832133 9:98415510-98415532 CATTTTCTGGGAAGGGAAGCTGG + Intronic
1057885928 9:98829618-98829640 CAGAGACTGGGAAGGGTAGTTGG - Intronic
1058127811 9:101215636-101215658 CAGAGGCTGGGAAGGGAAGCAGG - Intronic
1058256634 9:102774733-102774755 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1058323612 9:103666491-103666513 CAGAGGCTGGGGAGGTTAGTGGG + Intergenic
1058377101 9:104335486-104335508 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1058386738 9:104445130-104445152 CAAAGTCTGGGTAAGGAGGCAGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058728725 9:107828736-107828758 CAGAGACTGGAAAGGGAAGCTGG - Intergenic
1058855098 9:109053888-109053910 CAGAGACTTGGGAGGGAGCCTGG + Intronic
1058914638 9:109554008-109554030 CAGAGGCTGGGGACTGAAACAGG - Intergenic
1058966409 9:110043049-110043071 CAGAGGCTGGGAAAGGTAGCAGG - Intronic
1059075548 9:111189797-111189819 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060074637 9:120580215-120580237 CAGAGGACGGGCAGGGAAGCGGG + Intergenic
1060227769 9:121805808-121805830 CAGAGCCTGGGCAGGGGAGGAGG + Intergenic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060571989 9:124650424-124650446 CAGAGGCTGGGAAGGGTAGAGGG + Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061077799 9:128352456-128352478 AAGAGCCTGGTGATGGAAGCCGG + Intronic
1061440174 9:130597048-130597070 CAGAGGCTGGGAAGGGTAGTAGG - Intronic
1061703370 9:132433356-132433378 CAGAGTGTGGTAAGGGAAGAAGG - Intronic
1061906758 9:133703075-133703097 CCCGCTCTGGGGAGGGAAGCGGG - Intronic
1062024245 9:134333022-134333044 CAGAGCCTGGGGAGTGCAGGGGG - Intronic
1062261796 9:135666604-135666626 CAGGCTCTGGGAAGGGAAGGGGG - Intergenic
1062548952 9:137077334-137077356 CAGAGTCTGGGGTGCGCAGCGGG + Intergenic
1062572289 9:137191253-137191275 CAGAGCCTGGGGAGGGACCAAGG - Intergenic
1062740328 9:138170072-138170094 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1185558639 X:1041157-1041179 CAGAGGCCGGGCAGGGAGGCGGG + Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1185889479 X:3811517-3811539 CAGAGCCTCGGGAGGGGAGGAGG + Intergenic
1185961974 X:4554374-4554396 CAGAGCCTGGGAAGGGTAGTTGG + Intergenic
1185985833 X:4832049-4832071 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1186008468 X:5102259-5102281 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1186140340 X:6565270-6565292 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1186519565 X:10193501-10193523 CAGAGAGTGAGGAGGAAAGCAGG + Intronic
1186601627 X:11043937-11043959 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1186657171 X:11625525-11625547 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1186710078 X:12184827-12184849 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1186840543 X:13480574-13480596 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1186900283 X:14047522-14047544 CAGAAACTGGGGAGGGAATGGGG - Intergenic
1186924529 X:14318340-14318362 CAGAGCCTGGGAAGGGTAGGAGG + Intergenic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1187449511 X:19384329-19384351 CAGAGGCTGGGAAGGGCAGTGGG + Intronic
1187479746 X:19644204-19644226 CAGAGGCTGGGAAGGGTAGTTGG + Intronic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1187519313 X:19999930-19999952 CAATTTCTGGTGAGGGAAGCTGG + Intergenic
1187670441 X:21661029-21661051 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1187797946 X:23024818-23024840 CAGAATCTGATGAGGTAAGCAGG - Intergenic
1187837739 X:23452723-23452745 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1187841163 X:23490054-23490076 CAGAGGCTGGGAAGGGGAGGGGG + Intergenic
1187884718 X:23878776-23878798 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1188106535 X:26154187-26154209 CAGAGTCTGGGTAGGGTAGTGGG + Intergenic
1188206091 X:27360124-27360146 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1188275145 X:28191529-28191551 CAGAGGCTGGGAAGGGGAGTAGG - Intergenic
1188424834 X:30034707-30034729 CAGAGCCTGGGGATGGTAGTGGG - Intergenic
1188465356 X:30473362-30473384 CAAAAGCTGGGAAGGGAAGCAGG + Intergenic
1188692237 X:33144261-33144283 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1188724282 X:33562296-33562318 CAGAGGCTGGGAAGAGGAGCAGG - Intergenic
1188759583 X:34010521-34010543 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1188788270 X:34375840-34375862 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1188831663 X:34905857-34905879 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1188845464 X:35066518-35066540 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1188915084 X:35900871-35900893 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1188916465 X:35917466-35917488 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1188942918 X:36262368-36262390 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1189033716 X:37475072-37475094 CAGAGTCTGGGAAGGGTACTGGG + Intronic
1189076846 X:37925024-37925046 CAGAGGCTGGGAAGGGTAGGGGG - Intronic
1189088847 X:38056112-38056134 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1189299483 X:39942196-39942218 GAGGGGCTGGGGAGGGGAGCAGG + Intergenic
1189421084 X:40858620-40858642 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1189441755 X:41042574-41042596 CAGAGGCTGGGAAGGGTAGCAGG + Intergenic
1189577574 X:42370980-42371002 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1189612302 X:42750351-42750373 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1189627229 X:42911870-42911892 CAGAGGCTGGAAAGGGTAGCAGG + Intergenic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1189747273 X:44182098-44182120 CAGATTCTGGGTAGGGAGGAGGG - Intronic
1189873707 X:45411883-45411905 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1189889646 X:45586929-45586951 CAGAGACTGGAAAGGGTAGCTGG - Intergenic
1189935554 X:46064875-46064897 CAACCTCTGGGGAGGGAAGAAGG - Intergenic
1190142503 X:47860517-47860539 CATCCTCTGGGGAGGGAAGAGGG + Intronic
1190364737 X:49681017-49681039 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
1190373854 X:49769416-49769438 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1190381255 X:49841436-49841458 CAGACTCTCGGAAGGAAAGCAGG + Intergenic
1190412789 X:50153691-50153713 CAACCTCTGGGGAGGGAAGAGGG - Intergenic
1190475410 X:50822164-50822186 CAGAGGCTGGGAAGGGTAGAGGG + Intergenic
1190480144 X:50869211-50869233 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1190602497 X:52107197-52107219 CACAGTCTGGGAAGGGTAGTGGG - Intergenic
1190615846 X:52230116-52230138 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1190641978 X:52488640-52488662 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1190645694 X:52524226-52524248 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1190821312 X:53975710-53975732 CAGAGGCTGGGAAAGGAAGCGGG + Intronic
1190853149 X:54266286-54266308 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1191040639 X:56075664-56075686 CAGAGGCTGGGAAGGGTAGGTGG - Intergenic
1191057003 X:56252369-56252391 CAGAGGCTGGGAAGGGCAGTGGG - Intronic
1192028136 X:67477814-67477836 CAGAGTCTGAGAAGGGTAGTCGG + Intergenic
1192045351 X:67666209-67666231 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1192062867 X:67847821-67847843 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1192135678 X:68597462-68597484 CAGAGGCTGGGGAGAGTAGTCGG + Intergenic
1192227637 X:69240310-69240332 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1192381063 X:70616868-70616890 CAGAGGCTGGGAAGGGTTGCGGG + Intronic
1192633474 X:72794889-72794911 CAGAAGCTGGGGAGGGAAGGGGG - Intronic
1192648235 X:72925912-72925934 CAGAAGCTGGGGAGGGAAGGGGG + Intronic
1192680672 X:73250525-73250547 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1192725390 X:73745728-73745750 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1192758222 X:74067744-74067766 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1192813099 X:74565790-74565812 CAGAGACTGGGAAGGGTAGTGGG + Intergenic
1192821038 X:74645745-74645767 CAGAGTCTGGGAAGGATAGTAGG - Intergenic
1192844834 X:74895778-74895800 CAGAGGCTGGGAAGGGTAGGGGG + Intronic
1193093432 X:77520150-77520172 CAGAGGCTGAGAAGGGTAGCAGG + Intronic
1193178689 X:78427303-78427325 CAGACTCTGGGGAGGGGAGGTGG + Intergenic
1193268457 X:79501262-79501284 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1193541600 X:82779640-82779662 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1193558160 X:82982470-82982492 CAGAGTCTGAAAAGGGAAGCTGG + Intergenic
1193579181 X:83241844-83241866 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1193594454 X:83429329-83429351 CAGAGTCTGGGAACGGCAGTGGG + Intergenic
1193674061 X:84425797-84425819 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1193701951 X:84773841-84773863 CAGAGTCGGGGGAGGGGGGAGGG - Intergenic
1193835946 X:86343900-86343922 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1194079558 X:89443087-89443109 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
1194132424 X:90097320-90097342 CAGAGTCCGGGAAGGGTAGTGGG + Intergenic
1194164051 X:90491646-90491668 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1194214941 X:91118435-91118457 CAGAGTCTGGGAAGGGTAGGTGG - Intergenic
1194218310 X:91160308-91160330 CAGAGTCTGGAAAGGGTAGTGGG - Intergenic
1194263422 X:91727093-91727115 CAGAGGCTGGGAAGGGATGTGGG - Intergenic
1194326675 X:92527109-92527131 CAGAGTCTGGGAAGGGTAGCTGG + Intronic
1194514549 X:94835649-94835671 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1194586352 X:95739223-95739245 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1194774790 X:97949061-97949083 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1194799854 X:98259250-98259272 CAGAGACTGGGGAGGGAAAGAGG + Intergenic
1194863042 X:99028056-99028078 CAGAGGCTGGGAAGGGAACAGGG + Intergenic
1194902152 X:99525645-99525667 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1194925847 X:99822113-99822135 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1194992383 X:100558485-100558507 CAGAGGCTGGGAAGGGTAGTAGG + Intergenic
1195101359 X:101557213-101557235 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1195122343 X:101768085-101768107 CAGAGTCTGGGAAGGGTAGTGGG - Intergenic
1195380916 X:104269947-104269969 CAGAGACTGGGAAGGGAAGAAGG + Intergenic
1195400009 X:104451325-104451347 CAGAGCTTGGGTAGGGAAGAGGG - Intergenic
1195495715 X:105530732-105530754 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1195574935 X:106439016-106439038 CACAGATTGGGGAGGGAAGAGGG - Intergenic
1195592193 X:106642404-106642426 CAGAAGCTGGGAAGGGTAGCAGG - Intronic
1195592547 X:106647135-106647157 CAGAGGCTGGGAAGGGGAGTAGG - Intronic
1195596089 X:106691526-106691548 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1195645313 X:107224602-107224624 CAGAGACTGGGAAGGGCAGTGGG + Intronic
1195730416 X:107960932-107960954 CAGAGTCTGGGAAGTGAAGGTGG - Intergenic
1195813915 X:108864647-108864669 CAGAGTCTGGGAAGGGTAGAAGG - Intergenic
1195872003 X:109496068-109496090 CAGAGGCTGGGAAGAGTAGCGGG - Intergenic
1195941220 X:110169478-110169500 CAGAGTCGAGGCAGGGAGGCTGG - Intronic
1196003441 X:110810707-110810729 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1196056377 X:111360436-111360458 CAGAGACTGGGAAGGGTAGTGGG + Intronic
1196067405 X:111479683-111479705 CAGAGACTGGGGAGGGGATAAGG - Intergenic
1196119084 X:112029140-112029162 CAGAGGCTGGGAAGGGTAACGGG - Intronic
1196128185 X:112122424-112122446 CAGAGCCTGGGAAGGGGAGTGGG + Intergenic
1196157169 X:112443080-112443102 CAGAGTTTGGGAAGGGTAGCAGG - Intergenic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196219536 X:113096134-113096156 TAGAGCCTGGGGAGGGTAGTGGG + Intergenic
1196322672 X:114360689-114360711 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1196357110 X:114808119-114808141 CAGAGGCTGGGAAGGGTAGTGGG - Intronic
1196374760 X:115020931-115020953 CAGAGGCTGGGGAGGGAATAAGG - Intergenic
1196477000 X:116099033-116099055 CAGAGGTTGGGAAGGGTAGCTGG - Intergenic
1196509502 X:116491205-116491227 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1196598782 X:117576831-117576853 CAGAGGCTGGAAAGGGAAGTGGG - Intergenic
1196639876 X:118046382-118046404 CAGAGGCTGGGAAGGGTAGCTGG + Intronic
1196882894 X:120215139-120215161 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197019431 X:121668853-121668875 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1197028096 X:121780087-121780109 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1197068235 X:122260537-122260559 CAGAGGCTGGGAAGGGTAGCAGG - Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197226642 X:123961454-123961476 CGTAGTCGGGGGAGGAAAGCCGG + Intronic
1197286272 X:124598732-124598754 CAGAGGCTGGGAAGGGTAGTGGG + Intronic
1197441101 X:126492465-126492487 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1197522138 X:127511743-127511765 AAGAGTCAAGGGATGGAAGCGGG + Intergenic
1197621650 X:128757262-128757284 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1197642335 X:128980783-128980805 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1197796437 X:130303989-130304011 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1197963507 X:132031484-132031506 TAGAGGCTGAGAAGGGAAGCAGG - Intergenic
1197986761 X:132274359-132274381 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1198045325 X:132896109-132896131 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1198303173 X:135351019-135351041 AAGAGGCTGGAGAGAGAAGCAGG + Intronic
1198407674 X:136330994-136331016 CAGAGGCTGGGAAGGGTAGAGGG - Intronic
1198570400 X:137949057-137949079 CAGAGGCTGGGAAGGGTAGTTGG - Intergenic
1198654206 X:138895982-138896004 CAGAGGTTGGGGATGGAAGAAGG + Intronic
1198723725 X:139653797-139653819 CAGAGGCTGGGAAGGGTAGAGGG - Intronic
1198780942 X:140234923-140234945 CAGAGACTGGGAAGGGTAGTAGG - Intergenic
1198796581 X:140403080-140403102 CAGAGGCTGGGAAGGGCAGTGGG + Intergenic
1198831886 X:140759605-140759627 CAGTGACTTGGGAGGGAGGCAGG - Intergenic
1198871949 X:141185351-141185373 CAGAGGCTGGGAAGGGTAGTGGG - Intergenic
1198950873 X:142070717-142070739 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1199102192 X:143815527-143815549 CAGAGGCTGGTAAGGGTAGCGGG + Intergenic
1199140991 X:144312074-144312096 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1199276786 X:145953593-145953615 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1199361070 X:146919584-146919606 CAGAGGCTGGGCAGGGTAGTGGG - Intergenic
1199544713 X:148995773-148995795 CAGACTTTGAGGAGGGAAGGGGG + Exonic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1199646183 X:149914910-149914932 CAGAGGCTGGGAAGGGTAGTTGG + Intergenic
1199724405 X:150566964-150566986 CATAGTCTGGGGAGGGGAGTTGG + Intergenic
1199734748 X:150675242-150675264 CAGAGACTGAGGAGGGTAGTGGG + Intergenic
1199795933 X:151196779-151196801 CAGAGTCTGGGAAGGATAGTGGG - Intergenic
1199867421 X:151864719-151864741 CAGAGGCTGGGAAGGGTAGTAGG - Intergenic
1199925309 X:152456664-152456686 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1199982676 X:152929385-152929407 CAGGGACTGGGGAGAGAAGCGGG + Intronic
1200140619 X:153901058-153901080 CCGCCTCTGGGGAGGAAAGCGGG + Intronic
1200167710 X:154048655-154048677 CAGAGTCTAGGCAGGGATGCAGG + Intronic
1200174367 X:154102418-154102440 CAGAGACTGGGGAGAGGATCGGG + Intergenic
1200376901 X:155791620-155791642 CAGAGGCTGGGAAGGGTAGCTGG + Intergenic
1200406807 Y:2820297-2820319 CAGAGGCTAGGGAGGGTAGTGGG - Intergenic
1200432178 Y:3098394-3098416 CAGAGACTGGGAAGGGTAGTGGG - Intergenic
1200478220 Y:3667406-3667428 CAGAGTCTGGGAAGGGTAGTGGG + Intergenic
1200510311 Y:4069455-4069477 CAGAGGCTGGGAAGGGTAGTGGG + Intergenic
1200554824 Y:4624096-4624118 CAGAGTCTGGAGAGGGTAGTGGG - Intergenic
1200635394 Y:5646333-5646355 CAGAGTCTGGGAAGGGTAGCCGG + Intronic
1200799174 Y:7370187-7370209 CAGAGTCTGGGGCTGGAGCCTGG + Intergenic
1201945023 Y:19502330-19502352 CAGAGAGGGGGAAGGGAAGCAGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1202582649 Y:26398330-26398352 AGGAGTCTGAGGAGGGAAGATGG - Intergenic