ID: 1196889835

View in Genome Browser
Species Human (GRCh38)
Location X:120281309-120281331
Sequence CCCAGAACGTTGAGAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1380
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 1332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196889835_1196889840 -6 Left 1196889835 X:120281309-120281331 CCCCTTGCTCTCAACGTTCTGGG 0: 1
1: 0
2: 3
3: 44
4: 1332
Right 1196889840 X:120281326-120281348 TCTGGGTGGACCTAGAGAAACGG 0: 1
1: 0
2: 1
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196889835 Original CRISPR CCCAGAACGTTGAGAGCAAG GGG (reversed) Intronic
900144946 1:1154536-1154558 CCCAGCACTTTGGGAGCATGAGG + Intergenic
900200629 1:1404093-1404115 CCCAGTATGTTGAGAGGCAGAGG - Intronic
900726349 1:4218799-4218821 CCCAGAAAGCTGAGAGGAGGGGG - Intergenic
900869101 1:5289211-5289233 CCCTGAAGCTTGTGAGCAAGGGG - Intergenic
901293587 1:8143725-8143747 CCCAGAACTTTGGGAGGATGAGG + Intergenic
901373949 1:8824116-8824138 CCCAGCACTTTGAGAGCCAAAGG + Intergenic
901390744 1:8944318-8944340 CCCAGCACTTTGGGAGCACGAGG + Intergenic
901515989 1:9746463-9746485 CCCAGAACTTTGAGAGGCTGAGG + Intronic
901524383 1:9810223-9810245 CCCAGAACTTTGAGAGGCCGAGG + Intronic
901544369 1:9944309-9944331 CCCAGCACTTTGAGAGCCCGCGG + Intronic
901553039 1:10010364-10010386 CCCAGAACTTTGGGAGGCAGAGG - Intronic
901655881 1:10768888-10768910 CCCAGCACTTTGAGAGGCAGAGG + Intronic
901795701 1:11678162-11678184 CCCAGCACTTTGAGAGGATGAGG + Intronic
901854575 1:12036453-12036475 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
902073039 1:13758191-13758213 CCCAGCACTTTGAGAGGCAGAGG + Intronic
902358447 1:15926143-15926165 CCCAGAACTTTGAGAGACTGAGG + Intronic
902674294 1:17997774-17997796 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
902905658 1:19554891-19554913 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
903150465 1:21404434-21404456 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
903272135 1:22196221-22196243 CCCAGATCAGTGAGGGCAAGTGG - Intergenic
903392963 1:22977617-22977639 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
903507422 1:23847769-23847791 CCCAGCACTTTGAGAGGCAGAGG + Intronic
903520515 1:23944093-23944115 CCCAGAACATTGGGAGCCTGAGG - Intergenic
903598912 1:24519300-24519322 CCCAGCACTTTGAGAGGCAGAGG - Intronic
903614102 1:24639664-24639686 ACCAGAAGGTTGAAGGCAAGTGG + Intronic
903790803 1:25891744-25891766 CCCAGAATGAGGAGAGCAGGGGG - Intronic
903852115 1:26314028-26314050 CCCAGAACTTTGAGAGGCCGAGG - Intronic
903858001 1:26348304-26348326 CCCAGAACTTTGGGAGGCAGAGG + Intronic
903921124 1:26801820-26801842 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
903922764 1:26812708-26812730 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
904045550 1:27606179-27606201 CCCAGTAGGTTGAGATGAAGGGG + Intergenic
904190740 1:28741542-28741564 CCCAGAACTTTGGGAGACAGAGG - Intronic
904308637 1:29610430-29610452 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
904354196 1:29927882-29927904 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
904443853 1:30551645-30551667 CCAAAAACGTGGCGAGCAAGGGG - Intergenic
904487397 1:30836004-30836026 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
904793135 1:33038800-33038822 CCCAGCACTTTGAGAGCCTGAGG + Intronic
905078316 1:35293899-35293921 CCCAGCACTTTGGGAGCACGAGG + Intronic
905098318 1:35495120-35495142 CCCAGCACTTTGAGAGGACGAGG + Intronic
905392761 1:37648362-37648384 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
905423786 1:37866981-37867003 CCCAGAACTTTGGGAGGCAGAGG + Intronic
905574797 1:39035409-39035431 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
905636509 1:39557417-39557439 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
905753128 1:40483824-40483846 CCCAGCACTTTGGGAGCCAGAGG + Intronic
905828264 1:41043681-41043703 CCCAGCACTTTGAGAGCCTGAGG - Intronic
906089158 1:43163364-43163386 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
906271299 1:44481170-44481192 CCCAGCACGTTGAGAGGCTGAGG + Intronic
906349600 1:45046773-45046795 CCCAGCACTTTGAGAGGCAGAGG + Intronic
906384543 1:45356381-45356403 CCTAGAACTTTGAGAGGTAGAGG + Intronic
907009475 1:50950088-50950110 CCCAGCACTTTGAGAAGAAGAGG - Intronic
907040326 1:51253073-51253095 CCCAGCACGTTGGGAGGCAGAGG - Intronic
907067567 1:51501155-51501177 CCCAGCACTTTGAGAGCCCGAGG + Intronic
907104895 1:51873936-51873958 CCCAGCACTTTGAGAGGCAGAGG + Intronic
907135381 1:52135369-52135391 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
907222624 1:52918273-52918295 CCCAGCACGTTGAGAGGGTGAGG - Intronic
907337007 1:53706402-53706424 CCTAGATGGTTGAGAGGAAGAGG + Intronic
907382675 1:54104242-54104264 CCCAGAACTATGAGAACAGGAGG - Intronic
907614865 1:55913392-55913414 CCCACAATGTGGTGAGCAAGGGG - Intergenic
907696619 1:56736664-56736686 CCCAGCACTTTGAGAGGCAGAGG - Intronic
908191390 1:61707002-61707024 CCCAGCACCTTGAGAGCCCGAGG + Intronic
908891393 1:68852440-68852462 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
909460759 1:75910521-75910543 CCCAGCACTTTGGGAGGAAGAGG - Intronic
909623561 1:77691166-77691188 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
909656864 1:78042517-78042539 CCCAGCACTTTGAGAGGCAGAGG - Intronic
909814073 1:79968782-79968804 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
909930007 1:81487003-81487025 CCCAGAACTTTGAGAGGCTGAGG + Intronic
910259943 1:85284838-85284860 CCCACAACGTGGTAAGCAAGGGG - Intergenic
910602071 1:89043035-89043057 CCCACAACATGGTGAGCAAGGGG + Intergenic
910654880 1:89609485-89609507 CCCACAACGTGGCGAGCAAGGGG + Intergenic
911324422 1:96452950-96452972 CCCAGTACTTTGAGAGGCAGAGG + Intergenic
911453297 1:98093336-98093358 CCCAGAACTTTGGGAGGTAGAGG + Intergenic
912221206 1:107677960-107677982 CCAAGAAAGATGCGAGCAAGAGG + Intronic
912404207 1:109423186-109423208 CCCAGCACGTTGGGAGGATGAGG + Intronic
912568770 1:110607063-110607085 CCCAGACCGGGGAGATCAAGGGG - Intronic
912845505 1:113071531-113071553 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
912981863 1:114381456-114381478 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
912994427 1:114518711-114518733 TCCAGAATGTAGAAAGCAAGTGG - Intergenic
913028345 1:114870261-114870283 CCCAGTACTTTGAGAGGATGAGG - Intronic
914866840 1:151437499-151437521 CCCAGAACGTTGAGAAGCCGTGG + Intronic
915050269 1:153062831-153062853 CCCAGCACGTTGAGAGGTCGAGG + Intergenic
915081283 1:153354448-153354470 CCCAGCACTTTGGGAGCACGAGG - Intergenic
915185038 1:154098330-154098352 CCCACAACGTGGTGAGCAAGGGG + Intronic
915226037 1:154412195-154412217 CCCAGCACTTTGAGAGGACGAGG - Intronic
915373567 1:155372557-155372579 CCCAGAACTTTGAGAGGCTGAGG - Intronic
915478679 1:156170211-156170233 CCCAGAACTTTGGGAGGCAGTGG + Intronic
915485279 1:156216138-156216160 CCCAGCACTTTGAGAGGCAGAGG + Intronic
915501348 1:156320495-156320517 CCCAGCACTTTGAGAGCCTGAGG + Intronic
915574350 1:156765721-156765743 CCCAGCACTTTGAGAGGCAGAGG - Intronic
916228211 1:162511415-162511437 CCCAGAACTTTGGGAGGCAGAGG - Intronic
916232062 1:162550242-162550264 CCCAGCACTTTGAGAGGATGAGG + Intergenic
916669054 1:166995488-166995510 CCCAGCACTTTGAGAGCCTGAGG - Intronic
916777009 1:167977152-167977174 CCCAGAGCTTTGAGAGGCAGAGG - Intronic
916996609 1:170308332-170308354 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
917539704 1:175900886-175900908 CCCAGAGGGTTGAGAGGAAGTGG - Intergenic
917567068 1:176223797-176223819 CCCAGCACTTTGAGAGACAGAGG + Intergenic
918727093 1:187939858-187939880 CCCAGCACTTTGGGAGCAGGTGG - Intergenic
918988081 1:191659828-191659850 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
918997103 1:191775830-191775852 CCCAGAACTTTGGGAGCCTGAGG + Intergenic
919220061 1:194616718-194616740 CCCAGCACATTGAGAGGCAGAGG + Intergenic
919239620 1:194895874-194895896 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
919346010 1:196379318-196379340 CCCAGAACTTTGGGAGCTGGAGG + Intronic
919528683 1:198687234-198687256 CCCAGAACTTTGGGAGGGAGAGG - Intronic
919672251 1:200348307-200348329 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
919902790 1:202056603-202056625 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
920137226 1:203779815-203779837 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
920345009 1:205300804-205300826 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
920359836 1:205407079-205407101 CCCAGCACTTTGAGAGCCTGAGG + Intronic
920677607 1:208048971-208048993 CCCAGAATGATGAGGGCATGAGG - Intronic
920841579 1:209559829-209559851 CCCAGTACTTTGGGAGGAAGAGG + Intergenic
920951725 1:210577894-210577916 CCCAGAACTTTGAGAGGCTGAGG - Intronic
921217308 1:212949237-212949259 CCCAGCACTTTGGGAGAAAGAGG - Intergenic
921447720 1:215266165-215266187 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
921701731 1:218276162-218276184 CCCAGCACTTTGAGAGACAGAGG + Intergenic
921954475 1:220967779-220967801 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
922109777 1:222545778-222545800 CCCAGCACTTTGAGAGGATGAGG + Intronic
922148065 1:222968681-222968703 CCTAGCACTTTGAGAGCCAGAGG + Intronic
922315780 1:224440473-224440495 CCCAGAACTTTGGGAGGAAAAGG - Intronic
922504770 1:226120211-226120233 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
922656879 1:227392871-227392893 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
922660206 1:227423483-227423505 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
922681807 1:227604637-227604659 CCCAGCACTTTGAGAGGCAGAGG - Intronic
923600745 1:235400648-235400670 CCCAGCACTTTGAGAGGCAGAGG - Intronic
923666582 1:236003617-236003639 CCCAGAACTTTGGGAGGCAGAGG + Intronic
923945691 1:238884719-238884741 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
924133205 1:240934208-240934230 CCCAGCACTTTGAGAGGCAGAGG - Intronic
924391528 1:243565473-243565495 CCCAGAACTTTGAGAGGCTGAGG - Intronic
924680002 1:246221434-246221456 CCCACAACGTGGCGAGCAAGGGG - Intronic
924742286 1:246801824-246801846 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
924744101 1:246816552-246816574 CCCAGCACTTTGAGAGGACGAGG - Intergenic
924755143 1:246933512-246933534 CCCAGCACGTTGAGAGGCTGAGG - Intergenic
1063233689 10:4090498-4090520 CCCAGCACTTTGAGAGGCAGGGG + Intergenic
1063304600 10:4885785-4885807 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1063390118 10:5644565-5644587 CCCAGCACTTTGAGAGCCTGAGG + Intronic
1063405457 10:5790391-5790413 CCCAGCACGTTGGGAGAACGAGG + Intronic
1064040089 10:11954381-11954403 CCCAGAACGTTGGGAGGCCGAGG + Intronic
1064052880 10:12073281-12073303 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1064425847 10:15228595-15228617 CCCAGCACCTTGGGAGGAAGAGG - Intronic
1064439144 10:15337696-15337718 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1064611044 10:17102866-17102888 CCCAGCACTTTGAGAGGATGAGG - Intronic
1065033562 10:21613650-21613672 CCCAGCACTTTGAGAGACAGAGG + Intronic
1065154170 10:22852731-22852753 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1065292471 10:24244813-24244835 CCCAGCACTTTGAGAGGATGAGG - Intronic
1066079082 10:31911562-31911584 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1066090653 10:32015891-32015913 CCCAGCACTTTGAGAGCCTGAGG + Intronic
1066175709 10:32903099-32903121 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1066244702 10:33571260-33571282 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
1066416764 10:35228979-35229001 CCCAGCACTTTGAGAGAACGAGG + Intergenic
1067365996 10:45629310-45629332 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1067844022 10:49704488-49704510 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1068083654 10:52348154-52348176 CCCACAATGTGGTGAGCAAGGGG - Intergenic
1068348527 10:55814205-55814227 CCCACAACATGGTGAGCAAGGGG - Intergenic
1068497819 10:57807542-57807564 CCCAGAACTTTGGGAGGAAAAGG + Intergenic
1068896461 10:62209017-62209039 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1068975385 10:63003517-63003539 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1069007504 10:63334956-63334978 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1069009651 10:63357554-63357576 CCCAGCACGTTGGGAGGCAGAGG - Intronic
1069086972 10:64152029-64152051 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1069102634 10:64342017-64342039 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1069156332 10:65035145-65035167 CCCACAATGTGGTGAGCAAGAGG - Intergenic
1069487427 10:68833018-68833040 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1069547696 10:69340498-69340520 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1069593025 10:69653558-69653580 CCCACAACTTGGAGAGCAAGGGG - Intergenic
1069669653 10:70190971-70190993 CCCAGAACTTTGGGAGCCTGAGG + Intergenic
1069980978 10:72252384-72252406 CCCAGAATTTAGAGAGCACGTGG + Intergenic
1069995439 10:72339283-72339305 CCCAGCACTTTGGGAGGAAGGGG + Intronic
1070015398 10:72524351-72524373 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1070038695 10:72753622-72753644 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1070201760 10:74213344-74213366 CCCAGCACTTTGAGAGAATGAGG - Intronic
1070300388 10:75199406-75199428 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1070839330 10:79472609-79472631 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1071466984 10:85950325-85950347 GCAAGAACATTGAGAGAAAGTGG + Intronic
1071556540 10:86607193-86607215 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1071575704 10:86724352-86724374 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1071706759 10:88007676-88007698 CCCAGAACTTTGGGAGTACGAGG + Intergenic
1072131466 10:92498370-92498392 CCCAGCACTTTGAGAGGACGGGG + Intronic
1072272226 10:93787655-93787677 CCCAGCACATTGGGAGGAAGAGG + Intronic
1072336157 10:94400543-94400565 CCCAGCACTTTGGGAGCCAGAGG - Intergenic
1072457148 10:95586701-95586723 CCCAGGACTTTGAGAGGCAGAGG - Intergenic
1072753393 10:98000215-98000237 CCCACAATATAGAGAGCAAGGGG - Intronic
1072871065 10:99120720-99120742 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1073210592 10:101798662-101798684 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1073270432 10:102258404-102258426 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1073311456 10:102545721-102545743 CCCAGCACTTTGAGAGGTAGAGG + Intronic
1073581563 10:104671586-104671608 CCCAGCACTTTGAGAGCCTGAGG - Intronic
1073770002 10:106725678-106725700 CCCAGTACTTTGAGAGGCAGAGG + Intronic
1074392458 10:113069478-113069500 CCCAGCACTTTGAGAGGTAGAGG - Intronic
1074596713 10:114874752-114874774 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1074926953 10:118083322-118083344 CCCAGCACTTTGAGAGGACGAGG - Intergenic
1074948999 10:118310221-118310243 CCCAGAACTTTGGGAGGCAGAGG + Exonic
1075007908 10:118843669-118843691 CCCACAATGTGGTGAGCAAGGGG - Intergenic
1075195783 10:120357964-120357986 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1075204346 10:120434073-120434095 CCCAGCACGTTGGGAGGCAGAGG + Intergenic
1075356173 10:121778851-121778873 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1075467341 10:122661706-122661728 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1075503123 10:122996437-122996459 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1075694276 10:124421907-124421929 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1076262245 10:129076222-129076244 CCCAGACCCTTGAGAGGAAGTGG - Intergenic
1076319792 10:129569490-129569512 CCCAGCACGTCGGGAGGAAGGGG - Intronic
1076406674 10:130216864-130216886 CCCAGCACATTGAGAGGCAGAGG - Intergenic
1077925296 11:6676201-6676223 CCCAGCACCTTGAGAGGCAGGGG - Intergenic
1078515801 11:12021252-12021274 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1078683018 11:13498103-13498125 CCCAGCACTTTGGGAGCGAGAGG - Intergenic
1079038258 11:17039602-17039624 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
1079149595 11:17885572-17885594 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1079196633 11:18333733-18333755 CCCAGAACTTTGAGAGGATGAGG - Intronic
1079220828 11:18559447-18559469 CCCAGCACTTTGAGAGGACGAGG - Intronic
1079235936 11:18690314-18690336 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1079606550 11:22375728-22375750 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1080412280 11:32037133-32037155 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1080579852 11:33633247-33633269 CCCAGGACTTTGGGAGAAAGAGG - Intronic
1080600085 11:33813770-33813792 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1080806644 11:35660248-35660270 CCCAGAACTTTGAGAGGTCGAGG + Intergenic
1081051188 11:38343417-38343439 CCCAGCACATTGGGAGGAAGAGG - Intergenic
1081379767 11:42400124-42400146 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1081626252 11:44657254-44657276 CCCAGCACTTTGAGAGGACGAGG + Intergenic
1081952778 11:47059852-47059874 CCCAGCACTTTGAGAGCCCGAGG + Intronic
1081959890 11:47128123-47128145 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1082023625 11:47554912-47554934 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1082278094 11:50243320-50243342 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1082859409 11:57840134-57840156 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1082925285 11:58539054-58539076 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1083268458 11:61558204-61558226 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1083801838 11:65050940-65050962 CCCAGCACGTTGGGAGGCAGAGG - Intronic
1083832392 11:65241292-65241314 CCCAGCACGTTGAGAGGTTGAGG + Intergenic
1083867052 11:65461054-65461076 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1084202343 11:67568999-67569021 CCCAGAACTTTGGGAGGACGAGG + Intergenic
1084252246 11:67908789-67908811 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1084322232 11:68379879-68379901 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1084344189 11:68533460-68533482 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1084761869 11:71278408-71278430 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1084886594 11:72212929-72212951 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1084939882 11:72606859-72606881 CCCAGAGGGCTGAGAGTAAGGGG - Intronic
1085092172 11:73726330-73726352 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1085366541 11:75951630-75951652 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1085397485 11:76214002-76214024 CCCAGCACTTTGAGAGGACGAGG + Intergenic
1085989793 11:81827975-81827997 CCCAGAACTTTGGGAGGGAGAGG - Intergenic
1086097750 11:83067739-83067761 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1086106177 11:83149893-83149915 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1087037833 11:93772534-93772556 CCCACAATGTGGTGAGCAAGGGG + Intronic
1087771257 11:102212829-102212851 CCCAGAACTTTGGGAGGACGAGG - Intronic
1088304886 11:108397068-108397090 CCCAGAACTTTGAGAGGCAAAGG + Intronic
1088455148 11:110025624-110025646 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1088474690 11:110223098-110223120 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1088628501 11:111751087-111751109 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1088887013 11:114015651-114015673 CCCAGCACGTTGAGAGGCTGAGG + Intergenic
1088972758 11:114788005-114788027 CCCAGGACATTCAGAGTAAGGGG + Intergenic
1089935704 11:122361876-122361898 CCCAGAACCTTGGGAGGCAGAGG - Intergenic
1089947512 11:122492745-122492767 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1090136951 11:124209143-124209165 CCCACAACATGGTGAGCAAGGGG + Intergenic
1090176029 11:124650520-124650542 CCCAGCACTTTGAGAGAATGAGG + Intronic
1090218373 11:124991932-124991954 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1090241576 11:125186399-125186421 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1090513472 11:127399750-127399772 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1090824438 11:130374382-130374404 CCCAGAACTTTGGGAGCCCGAGG + Intergenic
1090853458 11:130591137-130591159 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1091020104 11:132091730-132091752 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1091914451 12:4259723-4259745 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1092368963 12:7900583-7900605 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1092371216 12:7917852-7917874 CCCAGAACGTTGGGAGGCTGAGG + Intergenic
1092377073 12:7964758-7964780 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1092400264 12:8169937-8169959 CCCAGAACTTTGAGAGGCGGAGG + Intronic
1092599173 12:10040071-10040093 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1092668894 12:10839890-10839912 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1093466448 12:19454138-19454160 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1093467755 12:19467542-19467564 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1093473777 12:19532928-19532950 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1093615627 12:21220009-21220031 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1093704268 12:22257472-22257494 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1093860666 12:24162735-24162757 CCCATAACCTTGAGAGAAAAGGG - Intergenic
1094109208 12:26843225-26843247 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1094582500 12:31747305-31747327 CCCAGCACTTTGAGAGAACGAGG + Intergenic
1094700607 12:32867075-32867097 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1094702060 12:32879576-32879598 CCCAGAACTTTGAGAGGCAGAGG + Intronic
1094732311 12:33192089-33192111 CCCAGCACTTTGGGAGCCAGAGG - Intergenic
1095087926 12:38078477-38078499 CCCAGAACTTTGGGAGTCAGAGG - Intergenic
1095127859 12:38503233-38503255 CCCAGAACTTTGGGAGGACGAGG + Intergenic
1095435783 12:42186241-42186263 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1095907458 12:47392431-47392453 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1096065224 12:48734359-48734381 CCCAGAACTTTGGGAGGATGGGG - Intergenic
1096224688 12:49859280-49859302 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1096286259 12:50303216-50303238 CCCAGCACGTTGGGAGCCTGAGG + Intergenic
1096336822 12:50763380-50763402 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1096623874 12:52881118-52881140 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1096657431 12:53100410-53100432 CCCAGAACTTTGAGAAGCAGAGG - Intronic
1097085634 12:56466210-56466232 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1097536108 12:60872683-60872705 CCTACAACGTGGCGAGCAAGGGG + Intergenic
1097614170 12:61863739-61863761 CACAGAACATTCACAGCAAGTGG - Intronic
1097665115 12:62469191-62469213 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1098167434 12:67712793-67712815 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1098249654 12:68556140-68556162 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1098802924 12:74985075-74985097 CCCACAACATGGTGAGCAAGGGG + Intergenic
1099295471 12:80823238-80823260 CCCACAACGTTATGAGCAAGGGG - Intronic
1099886762 12:88540547-88540569 CCCAGAATTTTGAGAGGCAGAGG + Intronic
1099924297 12:88998718-88998740 CCCATAATCTTGAGAGCAACTGG + Intergenic
1100125589 12:91420935-91420957 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1100176807 12:92040098-92040120 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1100821988 12:98440034-98440056 TCCCCAAAGTTGAGAGCAAGAGG - Intergenic
1101019787 12:100542093-100542115 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1101330582 12:103754697-103754719 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1101924966 12:108964102-108964124 CCCAGCACTTTGAGAGCTCGAGG + Intronic
1101944532 12:109126430-109126452 CCCAGAACTTTGGGAGGAAGAGG + Intronic
1102163554 12:110788216-110788238 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1102342671 12:112135890-112135912 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1102370084 12:112375816-112375838 CCCAAAACTTTGAGAGGTAGAGG + Intronic
1103070637 12:117938401-117938423 CCCAGCACTTTGAGAGACAGAGG + Intronic
1103470313 12:121175057-121175079 CCCAGAACTTTGGGAGCCTGAGG + Intronic
1104009950 12:124923245-124923267 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1104010363 12:124925927-124925949 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1104413493 12:128578846-128578868 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1105002991 12:132703180-132703202 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1105064754 12:133186626-133186648 CCCAGAACTTTGAGAGGTCGAGG - Intronic
1105206163 13:18226567-18226589 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1105213206 13:18269897-18269919 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1105445811 13:20456221-20456243 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1106004416 13:25755654-25755676 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1106086856 13:26550620-26550642 CCCAGAACCTTGGGAGGAAGGGG - Intergenic
1106313108 13:28570894-28570916 CCCAGAACTTTGAGAGGTCGAGG - Intergenic
1107524663 13:41218372-41218394 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1107697519 13:43014765-43014787 CCCAGCACGTTGGGAGGCAGAGG + Intergenic
1107871037 13:44746679-44746701 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1108016948 13:46086223-46086245 CCCACAACGTGGCAAGCAAGGGG + Intronic
1108197672 13:48011086-48011108 CCCAGAACTTTGGGAGACAGAGG + Intergenic
1108240258 13:48456990-48457012 CCCACAACATGGCGAGCAAGGGG + Intronic
1108554335 13:51578376-51578398 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1108691789 13:52865719-52865741 CCCAGTACGTTGAGAGGCCGAGG - Intergenic
1109036348 13:57266355-57266377 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1109063450 13:57651586-57651608 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1109178425 13:59184274-59184296 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1109250237 13:60010853-60010875 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1109300113 13:60582332-60582354 CCCAGCACGTTGAGAGGCCGAGG - Intergenic
1109608675 13:64733958-64733980 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1109831213 13:67791353-67791375 CCCAGAACTTTGGGAGGAGGAGG + Intergenic
1110321977 13:74171013-74171035 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1110448014 13:75609416-75609438 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1110858743 13:80324969-80324991 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1110861867 13:80353348-80353370 CCCAGAACGTTGGGAGGTGGAGG + Intergenic
1110872815 13:80472275-80472297 CCCAGCACTTTGAGAGAAGGAGG + Intergenic
1111007516 13:82267574-82267596 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
1111320753 13:86624958-86624980 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1111505772 13:89186102-89186124 CCCACAAGGTGGTGAGCAAGGGG - Intergenic
1111523467 13:89435135-89435157 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1111609630 13:90587033-90587055 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1111724770 13:91992704-91992726 CCCAGAACTTTGGGAGGATGAGG - Intronic
1111811948 13:93102408-93102430 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1112042047 13:95556294-95556316 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1112058252 13:95711246-95711268 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1112393514 13:99007137-99007159 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1112942807 13:104885897-104885919 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1113026379 13:105945635-105945657 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1113134110 13:107070477-107070499 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1113477646 13:110596184-110596206 GCCAGAACTTTGAGAGCCTGAGG - Intergenic
1114004977 14:18302493-18302515 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1114042823 14:18694346-18694368 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1114320612 14:21544306-21544328 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
1114477592 14:23007900-23007922 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1115164210 14:30429752-30429774 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1115242275 14:31261480-31261502 CCCAGGAGGTTGAGACCAATTGG + Intergenic
1115364353 14:32540447-32540469 CCCAGCACTTTGAGAGGATGAGG - Intronic
1115459521 14:33644830-33644852 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1115629209 14:35226984-35227006 CCCAGAACTTTGGGAGACAGAGG - Intronic
1115683477 14:35768023-35768045 CCCAGCACTTTGAGAGCCTGAGG - Intronic
1115925511 14:38428958-38428980 CCCAGAACTTTGGGAGCCCGAGG - Intergenic
1115932882 14:38517322-38517344 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1115982828 14:39072560-39072582 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1116242026 14:42356182-42356204 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1117063374 14:51984795-51984817 CCTAAAACGTGGAGAGGAAGGGG - Intergenic
1117140508 14:52786252-52786274 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1117142211 14:52800610-52800632 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1117309296 14:54506189-54506211 CCCAGCACTTTGAGAGGCAGTGG + Intergenic
1117410754 14:55448904-55448926 CCCAGAACATTGAGAGGCCGAGG + Intronic
1117697539 14:58381319-58381341 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1117914435 14:60662332-60662354 CCCAGAACATTGAGAGGCTGAGG - Intergenic
1118049716 14:62013713-62013735 CCCAGAACGTTGGGAGACCGAGG + Intronic
1118186370 14:63542544-63542566 CCCAGAAGGTGGAGAAAAAGGGG + Intronic
1118205525 14:63719862-63719884 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1118212358 14:63777417-63777439 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1118216095 14:63809749-63809771 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
1118268059 14:64314625-64314647 CCCAGCACTTTGAGAGCCTGAGG + Intronic
1118288084 14:64495704-64495726 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1118473052 14:66093203-66093225 CTCACAACGTGGTGAGCAAGGGG + Intergenic
1118991057 14:70797485-70797507 CCCAGAACTTTGAGAGACTGAGG + Intronic
1119244105 14:73088888-73088910 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1119271361 14:73307981-73308003 CCCAGCACGTTGGGAGGACGAGG - Intronic
1119282082 14:73417854-73417876 CCCAGAACTTTGGGAGGATGAGG + Intronic
1119349412 14:73951574-73951596 CCCAGCACTTTGGGAGGAAGGGG - Intronic
1119402956 14:74376749-74376771 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1120004956 14:79346167-79346189 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1120014332 14:79453175-79453197 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1120235316 14:81883564-81883586 CCCAGCACGTTGGGAGGAAGAGG - Intergenic
1120447936 14:84624914-84624936 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
1120868166 14:89313313-89313335 CCCAGCACTTTGAGAGGCAGGGG + Intronic
1120910964 14:89666315-89666337 CTCAGCACGTTGGGAGCCAGAGG - Intergenic
1120949909 14:90031404-90031426 CCCAGCACTTTGAGAGCCTGGGG + Intronic
1121000299 14:90447232-90447254 TCCAGAACTTTGAGAGGCAGAGG + Intergenic
1121099002 14:91236935-91236957 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1121211189 14:92209048-92209070 TCCAGAACCCTGAGAGAAAGTGG + Intergenic
1121344037 14:93122060-93122082 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1121750952 14:96355919-96355941 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1121870914 14:97406181-97406203 CCCAGTACTTTGGGAGGAAGAGG + Intergenic
1122180937 14:99954082-99954104 GCCAGAATGATGAGAGGAAGAGG - Intergenic
1122282292 14:100630428-100630450 CCCAGAGCCTTGTGAGCAACTGG + Intergenic
1122545863 14:102522301-102522323 CCCAGAACGTTGGGAGGCCGAGG - Intergenic
1122583442 14:102786732-102786754 CCCAGCACTTTGAGAGGATGAGG + Intronic
1123219995 14:106845699-106845721 CCTAAAACGTACAGAGCAAGAGG + Intergenic
1123389433 15:19854727-19854749 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1123669202 15:22637934-22637956 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1124258536 15:28165539-28165561 CCCAGCACTTTGAGAGGATGAGG + Intronic
1124294353 15:28487853-28487875 CCCAGCACGTTGAGAGGCTGAGG + Intergenic
1124525175 15:30444409-30444431 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1124773481 15:32563304-32563326 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1125241329 15:37580779-37580801 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1125241619 15:37582822-37582844 CCCACAATGTAGTGAGCAAGGGG - Intergenic
1125327425 15:38550005-38550027 CCCAGCACTTTGAGAGGACGAGG + Intronic
1125381518 15:39091936-39091958 CCCACAACGTGGTGAGCAAGCGG + Intergenic
1125752436 15:42037638-42037660 CCCACAACGAAGTGAGCAAGGGG - Intronic
1125932388 15:43609771-43609793 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1125933052 15:43613598-43613620 CCCAGCACGTTGGGAGCCCGAGG - Intronic
1125945486 15:43709243-43709265 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1125946150 15:43713060-43713082 CCCAGCACGTTGGGAGCCCGAGG - Intergenic
1126120608 15:45248047-45248069 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1126150423 15:45518806-45518828 CCCAGCACGTTGGGAGCCTGAGG - Intronic
1126276361 15:46886817-46886839 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1126524916 15:49642660-49642682 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1126749467 15:51861891-51861913 CCCAGAACGTTGGGAGTCCGAGG - Intronic
1126760192 15:51963024-51963046 CCCAGCACTTTGAGAGGACGAGG + Intronic
1127069747 15:55277390-55277412 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1127089828 15:55456330-55456352 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1127126062 15:55813085-55813107 CCCAGCACTTTGAGAGCGTGAGG + Intergenic
1127427890 15:58873977-58873999 CCCAGAACGTTGGGAGGCTGAGG - Intronic
1127653585 15:61033856-61033878 CCCAGAACTTTGAGACCAGCTGG + Intronic
1128021783 15:64398149-64398171 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1128143304 15:65317224-65317246 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1128198089 15:65778646-65778668 CCCAGCACTTTGAGAGGATGAGG + Intronic
1128714722 15:69899821-69899843 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1129031458 15:72621134-72621156 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1129176530 15:73843756-73843778 CCCAGCACATTGAGAGGTAGAGG - Intergenic
1129736604 15:77969538-77969560 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1129752173 15:78073719-78073741 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1129797409 15:78388679-78388701 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1129800040 15:78406637-78406659 CCCACAACGTGGCAAGCAAGGGG - Intergenic
1130288674 15:82577307-82577329 CCCAGCACTTTGAGAGCCTGGGG - Intronic
1130986587 15:88848464-88848486 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1131101423 15:89692856-89692878 CCCAGAACTTTGGGAGCTCGAGG - Intronic
1131221866 15:90591212-90591234 CCCAGCACTTTGGGAGCATGAGG - Intronic
1131253443 15:90845780-90845802 CACAGAACCCTGTGAGCAAGGGG + Intergenic
1131690884 15:94826112-94826134 CCCAGAACTTTGAGAGACCGGGG + Intergenic
1131750418 15:95500621-95500643 CCCAGAAAGTTTATAGGAAGTGG - Intergenic
1132410909 15:101577787-101577809 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1132468948 16:91125-91147 CCCAGCACTTTGAGAGGATGAGG + Intronic
1132528507 16:430938-430960 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1132875864 16:2136702-2136724 CCCAGAACTTTGAGAGGGGGAGG + Intergenic
1133400622 16:5483918-5483940 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1133479253 16:6153784-6153806 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1133527150 16:6616683-6616705 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1133720509 16:8490208-8490230 CCCAGAACTTTGGGAGCCAGAGG + Intergenic
1133769731 16:8860798-8860820 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1133769793 16:8861267-8861289 CCTAGCACTTTGAGAGGAAGAGG - Intronic
1133819299 16:9222369-9222391 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1133892478 16:9893715-9893737 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1133941854 16:10316017-10316039 CCCAGAACGTTGGGAGGCCGAGG + Intergenic
1134211574 16:12281818-12281840 CCCAGCACTTTGAGAGAACGAGG + Intronic
1134445017 16:14324423-14324445 CCCAGCACTTTGAGAGGATGAGG - Intergenic
1134450484 16:14360309-14360331 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1134519117 16:14910635-14910657 CCCAGAACTTTGAGAGGGGGAGG - Intronic
1134554811 16:15155591-15155613 CCCAGAACTTTGAGAGGGGGAGG + Intergenic
1134706787 16:16309290-16309312 CCCAGAACTTTGAGAGGGGGAGG - Intergenic
1134812401 16:17178817-17178839 CCCAGAACTTTGTGAGCTCGAGG + Intronic
1134960753 16:18402834-18402856 CCCAGAACTTTGAGAGGGGGAGG + Intergenic
1135395663 16:22129935-22129957 CCCAGCACTTTGAGAGGATGAGG + Intronic
1135564236 16:23499608-23499630 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1135703022 16:24649557-24649579 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1136036961 16:27547873-27547895 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1136065321 16:27754560-27754582 CCCAGAAAGTGTAGAACAAGAGG + Intronic
1136126689 16:28188190-28188212 CCCAGAACTTTGAGAGGCATAGG - Intronic
1136572893 16:31107365-31107387 CCCAGCACTTTGAGAGGACGAGG - Intronic
1136637593 16:31535262-31535284 CCCAGCACTTTGAGAGAACGAGG + Intergenic
1137360058 16:47806058-47806080 CCGAGACAGGTGAGAGCAAGAGG + Intergenic
1137626025 16:49909252-49909274 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1137756770 16:50908560-50908582 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
1138112365 16:54334243-54334265 CCCAGCACTTTGGGAGAAAGAGG - Intergenic
1138164242 16:54785426-54785448 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1138437069 16:57008135-57008157 CCCAGAACTTTGGGAGGTAGAGG + Intronic
1138633928 16:58321513-58321535 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1138764513 16:59585715-59585737 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1139018894 16:62724349-62724371 CCCAGCACTTTGAGAGCCAAGGG + Intergenic
1139294283 16:65886691-65886713 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1139427739 16:66893663-66893685 CCCAGCACTTTGAGAGCCTGAGG - Intronic
1139445922 16:66998616-66998638 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1139483217 16:67242217-67242239 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1139595641 16:67956433-67956455 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1139782115 16:69360451-69360473 CCCAGCACTTTGAGAGGATGAGG + Intronic
1140079121 16:71727883-71727905 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1140272808 16:73481741-73481763 CCCAGGACTTTGAGAGGCAGAGG - Intergenic
1140532395 16:75678010-75678032 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1140613713 16:76633941-76633963 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1140656920 16:77150592-77150614 CCCAGCACGTTGAGAGCCCAAGG + Intergenic
1140789896 16:78381458-78381480 CCCTGGATGTTGGGAGCAAGTGG + Intronic
1141107568 16:81246077-81246099 CCCAGCACTTTGGGAGCACGAGG - Intronic
1141382837 16:83591157-83591179 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1141401375 16:83750045-83750067 CCCAGAACGTTGGGAGGCTGAGG + Intronic
1141463455 16:84191705-84191727 CCCAGGACGTGGGGAGCAGGGGG + Intronic
1141596176 16:85098165-85098187 CCCAGAAATCTGCGAGCAAGGGG - Intergenic
1142326021 16:89415202-89415224 CCCAGCACTTTGGGAGGAAGGGG - Intronic
1142376452 16:89709315-89709337 CCCAGAACCCTGAGGCCAAGGGG - Exonic
1142436827 16:90064967-90064989 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1142639389 17:1276884-1276906 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1142671489 17:1489422-1489444 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1142837422 17:2597657-2597679 TCCAGAACTTTGAGAGGCAGAGG - Intronic
1142858192 17:2744808-2744830 CCCAGAACTTTGGGAGACAGAGG + Intergenic
1142960114 17:3547368-3547390 CCCAGCACTTTGAGAGCTAGAGG + Intronic
1143003292 17:3809453-3809475 CCCAGAACTTTGGGAGGAAGAGG + Intergenic
1143081759 17:4386865-4386887 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1143530745 17:7501919-7501941 AGCAGAACGTCGAGGGCAAGCGG + Exonic
1143787606 17:9267736-9267758 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1144790598 17:17856464-17856486 CCCAGAGCCGTGGGAGCAAGGGG - Intronic
1145062194 17:19740264-19740286 CCCAGCAAGTTCACAGCAAGTGG - Intronic
1145064410 17:19752455-19752477 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1145180158 17:20742436-20742458 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1145320103 17:21761310-21761332 CCCTGAACATTGAAAGCAAAAGG + Intergenic
1145395575 17:22491645-22491667 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1145874903 17:28310329-28310351 CCCAGAATTTTGAGAGGCAGAGG - Intergenic
1145959088 17:28875628-28875650 CCCAGCACTTTGAGAGGATGAGG - Intergenic
1146781455 17:35677198-35677220 CCCAGGACATTGAGACCAACTGG - Intronic
1146805518 17:35862127-35862149 CCCAGCACGTTGAGAGGCTGAGG - Intronic
1146875797 17:36409648-36409670 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1146930603 17:36774839-36774861 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
1147060245 17:37870302-37870324 CCCAGAACGTTGGGAGGCTGAGG - Intergenic
1147063590 17:37903221-37903243 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
1147128419 17:38390035-38390057 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1147209406 17:38863175-38863197 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1147287682 17:39415558-39415580 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1147582329 17:41634408-41634430 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1147772410 17:42877158-42877180 CCCAGCACGTTGAGAGGCCGAGG - Intergenic
1147841335 17:43373914-43373936 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1147995560 17:44358440-44358462 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1148010752 17:44478959-44478981 CCCAGAACTTTTAGAGGCAGAGG - Intronic
1148072916 17:44918736-44918758 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1148409522 17:47452789-47452811 CCCAGAACGTTGGGAGGCCGAGG - Intergenic
1148514562 17:48204351-48204373 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1148641340 17:49190003-49190025 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1148966800 17:51442600-51442622 CCCAGAACCTTGAGTGTCAGAGG + Intergenic
1148980229 17:51567289-51567311 CCCAGAACTTTGGGAGGCAGTGG + Intergenic
1149017495 17:51925130-51925152 CCCAGAAGGCTTAAAGCAAGAGG - Intronic
1149091507 17:52788689-52788711 CCCAAAATGTTGAGAGAGAGAGG - Intergenic
1149329923 17:55570274-55570296 CCCACAACGTGGTGAGCAAGGGG - Intergenic
1149377253 17:56057533-56057555 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1149411606 17:56413926-56413948 CCCAGAACTTTGGGAGGATGAGG - Intronic
1149618922 17:58026960-58026982 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1149723017 17:58864685-58864707 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1150093656 17:62353114-62353136 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1150112401 17:62513584-62513606 CCCAACACTTTGAGAGCATGAGG - Intronic
1150191520 17:63245590-63245612 CCCAGCACGTTGAGAGGCTGAGG + Intronic
1150501361 17:65653808-65653830 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1150585405 17:66512941-66512963 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1151087069 17:71392257-71392279 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
1151099891 17:71544862-71544884 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1151193286 17:72413982-72414004 CCCAGATGTTTGAGAGCCAGCGG + Intergenic
1151357016 17:73565191-73565213 CCCAGAAGGAGGAGAGCCAGAGG + Intronic
1152172624 17:78763091-78763113 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1152437073 17:80282946-80282968 CCCAGCACTTTGAGAGAACGAGG - Intronic
1152620663 17:81363040-81363062 CCCAGAACTTTGGGAGGACGAGG + Intergenic
1152725949 17:81946102-81946124 CCCAGCACGTTGAGAGGCTGAGG + Intronic
1153108203 18:1552053-1552075 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1153209518 18:2745267-2745289 CCCAGAACTTTGCGAGAATGAGG - Intronic
1153569448 18:6454123-6454145 CCCAGAACTTTGGGAGCCTGGGG - Intergenic
1154242276 18:12663521-12663543 CCCAGCACCTTGGGAGGAAGAGG - Intronic
1154405026 18:14083097-14083119 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1154405091 18:14083657-14083679 CCCAGCACTTTGGGAGCATGAGG + Intronic
1154947422 18:21176031-21176053 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1155571149 18:27195274-27195296 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1156038447 18:32793090-32793112 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1156069925 18:33194811-33194833 CCCAGAACTTTGAGAGACTGAGG + Intronic
1156348088 18:36276134-36276156 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1157099723 18:44718374-44718396 CCCAGAGCTGTGAGAGCAGGAGG + Intronic
1157462392 18:47911099-47911121 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1157512319 18:48285600-48285622 CCCAGCACTTTGAGAGGACGAGG - Intronic
1157729706 18:49992855-49992877 TCCAGAAAGTTCAGAGCTAGTGG - Intronic
1157834040 18:50882696-50882718 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1158147790 18:54335442-54335464 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1158688093 18:59632857-59632879 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1158691656 18:59666714-59666736 CCCAGAACGTTGGGAGGCCGAGG + Intronic
1158975153 18:62704342-62704364 CCCAGCACTTTGAGAGCCCGAGG - Intergenic
1159046489 18:63373832-63373854 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1159823092 18:73171549-73171571 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1159870622 18:73756799-73756821 CCCAGAAAGGTGAGTGCGAGGGG + Intergenic
1160937253 19:1602700-1602722 CCCAGAACCTTGAGAGGCTGAGG - Intronic
1160964360 19:1739693-1739715 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1161018276 19:1994377-1994399 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1161365146 19:3874689-3874711 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1161423717 19:4190472-4190494 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1161426460 19:4206242-4206264 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1161439473 19:4282473-4282495 CCCAGCACGTTGGGAGCCCGAGG + Intronic
1161460405 19:4393367-4393389 CCCAGCACTTTGAGAGAATGAGG + Intronic
1161632214 19:5363639-5363661 CCCAGAACGTTGGGAGGCCGAGG - Intergenic
1161783418 19:6308659-6308681 CCCAGCACTTTGAGAGCTTGAGG - Intronic
1161862734 19:6810451-6810473 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1161871323 19:6872676-6872698 CCCAGCACGTTGAGAGGCCGAGG + Intergenic
1162206061 19:9056991-9057013 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
1162225856 19:9221599-9221621 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1162390237 19:10385429-10385451 CCCAGCACTTTGAGAGACAGAGG + Intergenic
1162425988 19:10596026-10596048 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1162447963 19:10735762-10735784 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1162619490 19:11829881-11829903 CCCAGAACTTTGGGAGCCTGAGG + Intronic
1162842481 19:13366545-13366567 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1162890973 19:13732857-13732879 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1163118468 19:15201453-15201475 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1163345890 19:16741858-16741880 CCCAGAACGTTGGGAGGCTGAGG + Intronic
1163405921 19:17122286-17122308 CCCAGCACTTTGGGAGTAAGAGG + Intronic
1163464805 19:17461114-17461136 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1163543068 19:17923310-17923332 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1163593956 19:18210127-18210149 CTCAGAAGGTTGAGACAAAGGGG - Exonic
1163838200 19:19589176-19589198 CCCAGCACGTTGAGAGGTCGAGG + Intronic
1163933939 19:20424569-20424591 CCCAGAACGTTGGGAGGCCGAGG - Intergenic
1164136186 19:22418626-22418648 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1164208155 19:23074946-23074968 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1164452321 19:28377481-28377503 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1164629289 19:29751393-29751415 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1164801175 19:31078149-31078171 CCCAGAAAGTTGGGAGGCAGAGG - Intergenic
1164945511 19:32289986-32290008 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1165033737 19:33017903-33017925 CCCAGCACTTTGAGAGCCTGAGG + Intronic
1165184184 19:34002592-34002614 CCCAGCACTTTGAGAGGACGAGG - Intergenic
1165355414 19:35300803-35300825 CCCAGGAGTTTGAGGGCAAGTGG - Intronic
1165385593 19:35508964-35508986 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1165867425 19:38947333-38947355 CCCAGCACTTTGAGAGCCCGAGG + Intronic
1165867546 19:38948224-38948246 CCCAGCACTTTGAGAGCCCGAGG - Intronic
1165919167 19:39282605-39282627 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1166188958 19:41162535-41162557 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1166309545 19:41955205-41955227 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1166335797 19:42106359-42106381 CCCAGCACTTTGAGAGGACGAGG - Intronic
1166512519 19:43418981-43419003 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1166520580 19:43477564-43477586 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1166649225 19:44558319-44558341 CCCAGCACATTGAGAGGCAGAGG + Intergenic
1166700972 19:44881424-44881446 CCCAGAACGTTGGGAGGCCGAGG + Intronic
1166949736 19:46418731-46418753 CCCAGCACTTTGAGACCCAGAGG - Intergenic
1167014631 19:46832815-46832837 CCCAGCACTTTGGGAGCAGGAGG + Intergenic
1167285703 19:48597882-48597904 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1167359353 19:49021858-49021880 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1167457402 19:49604250-49604272 CCCAGAACTTTGAGAGACTGAGG + Intronic
1167539958 19:50079521-50079543 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1167629745 19:50618247-50618269 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1167788867 19:51658633-51658655 GGCTGAACGTTAAGAGCAAGGGG - Intergenic
1167791802 19:51688076-51688098 CCTGGAAGGTTGTGAGCAAGGGG - Intergenic
1167889835 19:52530411-52530433 CCCAGCACGTTGGGAGACAGAGG + Intronic
1167972211 19:53195207-53195229 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1168157818 19:54486426-54486448 CCCAGCACTTTGAGAGGATGAGG - Intergenic
1168194357 19:54762617-54762639 CCTAGAACTTTGAGAGCCTGAGG - Intronic
1168249104 19:55131235-55131257 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1168619463 19:57866431-57866453 CCCAGCACTTTGAGAGGATGAGG + Intronic
1168649266 19:58082917-58082939 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1202656636 1_KI270708v1_random:29579-29601 CCCACAATGTGGAAAGCAAGGGG - Intergenic
925676273 2:6364696-6364718 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
925858020 2:8149364-8149386 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
926070442 2:9884347-9884369 CCCACAACATGGCGAGCAAGGGG + Intronic
926202176 2:10809424-10809446 CCCAGAACTTTGGGAGGATGAGG + Intronic
926298821 2:11587973-11587995 CCCAGAACTTTGAGAGGCCGAGG + Intronic
926509926 2:13762213-13762235 CCCAGCACTTTGAGAGACAGAGG + Intergenic
926555824 2:14356685-14356707 CCCAGAACGTTGGGAGGCAAAGG + Intergenic
927385278 2:22525371-22525393 CCCAGAATGTTGAGGCAAAGTGG + Intergenic
927621339 2:24663043-24663065 CCCAGAACTTTGGGAGACAGAGG - Intronic
927729670 2:25459855-25459877 CCCAGCACGTTGGGAGGACGAGG + Intronic
927775897 2:25902897-25902919 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
927994242 2:27471777-27471799 CCCAGCACTTTGAGAGGCAGAGG + Intronic
928161269 2:28927660-28927682 CCGAGCAAGTAGAGAGCAAGAGG + Exonic
928288454 2:30015222-30015244 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
928554202 2:32406139-32406161 CCCAGGACTTTGAGAGGTAGAGG + Intronic
928945242 2:36766097-36766119 CTCTGAAGGTTTAGAGCAAGGGG - Intronic
929536870 2:42789328-42789350 CCCAGCACTTTGAGAGGCAGAGG + Intronic
929692321 2:44085222-44085244 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
929823021 2:45288588-45288610 CCCAGAACCTTGGGAGGATGAGG - Intergenic
930612089 2:53554773-53554795 CCCACAATGTGGTGAGCAAGGGG - Intronic
930773318 2:55149440-55149462 CCCAGAACTTTGAGAGGTCGAGG + Intergenic
931223417 2:60308653-60308675 CCCAGAAGGTTGAGAGGACTTGG - Intergenic
931731699 2:65159307-65159329 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
931863035 2:66377291-66377313 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
932126703 2:69151436-69151458 CTCAGAATGTTGACACCAAGTGG + Intronic
932548195 2:72737601-72737623 CCCAGCACTTTGAGAGGATGAGG + Intronic
933061725 2:77745938-77745960 CCCAGCACTTTGAGAGCACAAGG - Intergenic
933375908 2:81479613-81479635 CCCAGCACGTTGAGAGGACAAGG + Intergenic
933472249 2:82740762-82740784 CCCAGCACCTGGAGAGCAGGAGG + Intergenic
933513046 2:83265226-83265248 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
933522593 2:83392118-83392140 CCCAGAACTTTGAGAGGTTGAGG + Intergenic
933837260 2:86256096-86256118 CCCAGCACTTTGGGAGGAAGAGG + Intronic
933970504 2:87466102-87466124 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
934301117 2:91776888-91776910 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
934518302 2:95003330-95003352 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
935168043 2:100586794-100586816 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
935243160 2:101195464-101195486 CCCAGAACTTTGAGAGGCCGAGG + Intronic
935293565 2:101629341-101629363 CCCAGAACTTTGGGAGGATGAGG - Intergenic
935400666 2:102656952-102656974 CCCAGAACTTTGAGAGGCCGAGG + Intronic
936003639 2:108861729-108861751 CCCAGCACTTTGGGAGGAAGAGG - Intronic
936158630 2:110067232-110067254 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
936186030 2:110304091-110304113 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
936323226 2:111484079-111484101 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
937543793 2:122990000-122990022 CCCACAACGTGGTAAGCAAGGGG - Intergenic
937933232 2:127221479-127221501 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
938153029 2:128902878-128902900 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
938401322 2:130994028-130994050 CCCAGCACTTTGGGAGCCAGAGG - Intronic
938416002 2:131104178-131104200 CCCAGAGCTTTGCGAGCCAGAGG - Intergenic
938531547 2:132192606-132192628 CCAAGCAAGATGAGAGCAAGTGG + Intronic
938952935 2:136273056-136273078 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
940034956 2:149303374-149303396 CCCAGCACGTTGAGAGGCTGAGG + Intergenic
940298014 2:152149746-152149768 CCCAGAACTTTGAGAGGCCGAGG - Intronic
940354805 2:152728808-152728830 CCCAGAACTTTGAGAGCCCCAGG + Intronic
940604401 2:155901837-155901859 CCCAGCACTTTGAAAGCCAGAGG + Intergenic
940642157 2:156356478-156356500 CACAAAAAGATGAGAGCAAGAGG - Intergenic
940780589 2:157929541-157929563 CCCAGAACTTTGGGAGGCAGAGG - Intronic
940857359 2:158739932-158739954 CCCAGAACTTTGTGAGGATGAGG + Intergenic
940915320 2:159248854-159248876 CCCAGCACTTTGAGAGGATGAGG - Intronic
940987091 2:160061521-160061543 CCCAGAACTTTGGGAGGACGAGG + Intronic
941294735 2:163722934-163722956 CCCAGCACATTGAGAGGCAGAGG + Intronic
941594606 2:167460201-167460223 CCCAGAAAAGTGAGAGGAAGGGG - Intergenic
941643788 2:168018247-168018269 CCCAGAACTTTGAGAGGCTGAGG + Intronic
941899242 2:170662499-170662521 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
942052154 2:172149757-172149779 CCCAGAAATTTGAGAGGCAGAGG - Intergenic
942053411 2:172161927-172161949 CCCACAACGTGGTGAGCAATGGG + Intergenic
942114133 2:172711612-172711634 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942651245 2:178170450-178170472 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
942664131 2:178298631-178298653 CCCAGCACTTTGGGAGGAAGAGG - Intronic
943828289 2:192425096-192425118 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
943965638 2:194328448-194328470 CCCACAACATGGAGAGAAAGGGG - Intergenic
944337609 2:198555712-198555734 CCCAGCACTTTGGGAGGAAGAGG - Intronic
944749073 2:202689665-202689687 CCCAGCACTTTGAGAGCCTGAGG + Intronic
944794531 2:203169448-203169470 CCCAGCACTTTGAGAGCTTGAGG + Intronic
945125839 2:206508403-206508425 CCCAGAACTTTGGGAGGCAGAGG + Intronic
945432292 2:209778150-209778172 CCCAGAACTTTGGGAGGCAGAGG + Intronic
945953294 2:216061039-216061061 CCCAGCACTTTGAGAGGCAGAGG + Intronic
946251000 2:218412283-218412305 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
946263123 2:218513239-218513261 CCCAGAAATTTGAGACCAACTGG - Intronic
946384708 2:219375803-219375825 CCCAGCACTTTGAGAGGTAGTGG - Intronic
946449949 2:219771346-219771368 CCCAGCACTTTGAGAGCAAGAGG - Intergenic
946732781 2:222725066-222725088 CCCAGCACTTTGAGAGCTCGTGG - Intergenic
946815350 2:223571520-223571542 CCCAGATCGCTGAGTGCAAGGGG + Intergenic
946919841 2:224567487-224567509 CCCAGCACCTTGGGAGGAAGAGG + Intronic
946925043 2:224618130-224618152 CCCAGCACTTTGAGAGCTTGAGG + Intergenic
947059709 2:226149837-226149859 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
947233762 2:227918942-227918964 CCCAGCACTTTGAGAGGAAAAGG + Intronic
947285085 2:228505503-228505525 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
947419482 2:229929311-229929333 CCCAGAACTTTGGGAGCCTGAGG + Intronic
948131597 2:235604830-235604852 CCCAGCACTTTGGGAGGAAGAGG - Intronic
948506668 2:238432994-238433016 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1169484809 20:6019930-6019952 CCCAGCACTTTGAGAGGTAGAGG - Intronic
1170005361 20:11662715-11662737 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1170560331 20:17551730-17551752 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1170609543 20:17901365-17901387 CCCAGAACCTTGAGAGGCTGAGG + Intergenic
1170638389 20:18129425-18129447 CCCAGAACTTTGGGAGCCAGAGG - Intergenic
1171292787 20:23992148-23992170 CCCAGTACTTTGAGAGGACGAGG - Intergenic
1171434942 20:25114692-25114714 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
1171477550 20:25423862-25423884 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1171806508 20:29685561-29685583 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1172147476 20:32766826-32766848 CCCAGCACTTTGAGAGGATGAGG - Intronic
1172268084 20:33634419-33634441 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1172440012 20:34958712-34958734 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1172549449 20:35787719-35787741 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1172558970 20:35868838-35868860 CCCAGAACTTTGGGAGGACGAGG + Intronic
1172628827 20:36364842-36364864 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1172708819 20:36903799-36903821 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1172805042 20:37605815-37605837 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1173089736 20:39958878-39958900 TCCAGAACATTTAGAGCCAGAGG - Intergenic
1173207534 20:41006622-41006644 CCCACAACGTGGTGAGCAAGAGG + Intergenic
1173239257 20:41279025-41279047 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1173259658 20:41422385-41422407 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1173285444 20:41667580-41667602 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1173383674 20:42568797-42568819 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1173603620 20:44313314-44313336 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1173603967 20:44316357-44316379 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1174032494 20:47641433-47641455 CCCAGAACTTTGGGAGGTAGAGG - Intronic
1174091766 20:48054547-48054569 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
1174450134 20:50614806-50614828 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1174634459 20:51987053-51987075 CCCAGCACTTTGAGAGGACGAGG - Intergenic
1174671039 20:52307865-52307887 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1174884848 20:54322345-54322367 CCCAGAACGTTGGGAGGCCGAGG + Intergenic
1175056154 20:56200320-56200342 CCCAGAACTTTGAGAGACTGAGG - Intergenic
1175640934 20:60629567-60629589 CCCAGCACTTTGAGAGACAGAGG + Intergenic
1175905192 20:62376197-62376219 CCCAGCACTTTGAGAGGATGAGG - Intergenic
1176002302 20:62837864-62837886 CCCAGCACGTTGGGAGGACGAGG + Intronic
1176017377 20:62942201-62942223 CCCAGCACTTTGAGAGACAGAGG + Intronic
1176642344 21:9318005-9318027 CCCACAATGTGGCGAGCAAGGGG - Intergenic
1176764913 21:13006824-13006846 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1177336216 21:19731967-19731989 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1177637465 21:23806306-23806328 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1177937269 21:27365263-27365285 CCAAGAACTTTGAGAGGCAGAGG - Intergenic
1178405334 21:32318592-32318614 ACCAGAAGGTTGGTAGCAAGAGG - Intronic
1178879501 21:36437614-36437636 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1178997368 21:37415715-37415737 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1179278605 21:39914328-39914350 CCCAGCACTTTGGGAGCAAGTGG + Intronic
1179518616 21:41927406-41927428 CCCAGCACTTTGAGAGCCTGAGG - Intronic
1179809799 21:43863855-43863877 CCCAGCACTTTGAGAGGAGGAGG + Intergenic
1180341926 22:11626943-11626965 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1180351357 22:11807359-11807381 CCCACAATGTGGCGAGCAAGGGG - Intergenic
1180386845 22:12184718-12184740 CCCACAATGTGGCGAGCAAGGGG + Intergenic
1180429489 22:15233283-15233305 CCAAGCAAGATGAGAGCAAGTGG - Intergenic
1180631727 22:17234514-17234536 CCCAGCACTTTGAGAGGTAGAGG + Intergenic
1180816034 22:18790242-18790264 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1180863126 22:19098842-19098864 CCCAAAACTTTGAGAGCATAAGG - Intronic
1181202221 22:21224584-21224606 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1181399208 22:22641085-22641107 CCCAGTACTTTGAGAGGACGAGG + Intergenic
1181476579 22:23171591-23171613 CCCAGCACCTTGAGAGGCAGTGG + Intergenic
1181501929 22:23320433-23320455 CCCAGTACTTTGAGAGGACGAGG + Intergenic
1181699479 22:24612053-24612075 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1181707164 22:24655763-24655785 CCCAGTACTTTGAGAGGACGAGG + Intergenic
1181780785 22:25191404-25191426 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1182272596 22:29164860-29164882 CCCAGCACTTTGGGATCAAGAGG + Intronic
1182335643 22:29581610-29581632 CCCAGCACTTTGGGAGCACGAGG - Intergenic
1182483278 22:30623500-30623522 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1182657305 22:31900823-31900845 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1182673573 22:32018635-32018657 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1182841320 22:33392406-33392428 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1182995687 22:34809878-34809900 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1183066012 22:35363287-35363309 CCCAGCACTTTGAGAGCCCGAGG - Intergenic
1183138428 22:35913221-35913243 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1183525787 22:38321684-38321706 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1183541667 22:38432716-38432738 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1183542736 22:38438993-38439015 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1183867439 22:40714943-40714965 CCCAGAACCGTGAGATCAAAGGG - Intergenic
1184090070 22:42288285-42288307 CCCAGAACGTTGGGAGGCCGAGG + Intronic
1185257989 22:49847173-49847195 CCCAGGACTTTGAGAGCCCGAGG + Intergenic
1203224689 22_KI270731v1_random:70841-70863 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1203266137 22_KI270734v1_random:15943-15965 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
949218484 3:1600646-1600668 CCCTCAACATGGAGAGCAAGAGG + Intergenic
949524734 3:4891937-4891959 CCCAGCACGTTGGGAGGATGAGG + Intergenic
949702763 3:6778353-6778375 CCCAGAACTTTGGGAGGCAGAGG + Intronic
949902779 3:8832769-8832791 CCCAGAACTTTGGGAGGCAGAGG + Intronic
950236768 3:11328834-11328856 CCCAGAACTTTGGGAGGATGAGG + Intronic
950471910 3:13191585-13191607 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
950799682 3:15540064-15540086 CCCAGAACTTTGAGAGACCGAGG + Intergenic
950970867 3:17186456-17186478 CCCAGCACTTTGAGAGGCAGAGG + Intronic
951334298 3:21402841-21402863 CCCAGAACTTTGAGAGGTGGGGG + Intergenic
951545318 3:23819032-23819054 CCCAGCACTTTGGGAGGAAGAGG + Intronic
951562357 3:23981600-23981622 CCCACAGCGTGGTGAGCAAGGGG + Intergenic
951731421 3:25814172-25814194 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
951876959 3:27437944-27437966 CCCAGCACTTTGAGAGGCAGAGG + Intronic
952301681 3:32109097-32109119 CCCAGCACTTTGGGAGGAAGAGG - Intronic
952314487 3:32220832-32220854 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
952408611 3:33027025-33027047 CCCACAACGTGGTGAGCAAGGGG - Intronic
952510557 3:34049397-34049419 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
952928969 3:38345247-38345269 CCCAGCACTTTGAGAGGATGAGG + Intergenic
953095269 3:39768490-39768512 CACAGAACTTGAAGAGCAAGTGG - Intergenic
953230172 3:41057839-41057861 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
953697594 3:45172009-45172031 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
953748114 3:45590666-45590688 CCCACAACGTGGCAAGCAAGGGG + Intronic
953834817 3:46333432-46333454 CATAGAACTTTGGGAGCAAGTGG + Intergenic
953983348 3:47423852-47423874 CACAGAGCGTTAACAGCAAGAGG + Intronic
954027362 3:47793824-47793846 CCCAGCACTTTGAGAGGACGAGG - Intergenic
954067988 3:48122151-48122173 CCCAGTACTTTGAGAGAACGAGG + Intergenic
954142888 3:48619371-48619393 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
954182608 3:48893418-48893440 CCCAGAACTTTGGGAGGCAGAGG + Intronic
954260493 3:49435223-49435245 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
954264946 3:49464671-49464693 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
954289050 3:49639446-49639468 CCCAGCACTTTGAGAGGCAGAGG - Intronic
956712988 3:72054618-72054640 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
956826405 3:73001305-73001327 CCCAGAACTTTGAGAGGCTGAGG + Intronic
957184195 3:76921359-76921381 CCCAGCACTTTGGGAGGAAGAGG + Intronic
957427096 3:80052219-80052241 CCCACAACATGGCGAGCAAGGGG - Intergenic
957636408 3:82791155-82791177 CCCACAATGTAGTGAGCAAGGGG - Intergenic
957638253 3:82815157-82815179 CCCACAACGTGGTGAGCAAGGGG + Intergenic
957658973 3:83121487-83121509 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
957753334 3:84453194-84453216 CCCAGAACTTTGAGAGGCGGAGG - Intergenic
957848260 3:85768194-85768216 CCCAGCACTTTGAGAGGCAGAGG + Intronic
959881679 3:111450730-111450752 CCCAGCACTTTGAGAGTCAGAGG + Intronic
960037848 3:113119429-113119451 CCCAGCACTTTGAGAGCCTGAGG - Intergenic
960196039 3:114769806-114769828 CCCAGAACTTTGGGAGGACGAGG + Intronic
960269358 3:115657806-115657828 CCCAGAACTTTGGGAGGCAGAGG - Intronic
960316038 3:116178416-116178438 CCCAGCACTTTGAGAGGATGAGG - Intronic
960573764 3:119209671-119209693 CCCAGTACTTTGGGAGGAAGAGG + Intergenic
960613119 3:119572841-119572863 CCCAGTACGTTGGGAGGCAGAGG - Intergenic
961183215 3:124892432-124892454 CCCAGCACTTTGGGAGGAAGGGG + Intronic
961744339 3:129054296-129054318 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
962226399 3:133614039-133614061 CCCAGAACTTTGAGAGGCTGAGG - Intronic
962306228 3:134289016-134289038 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
962355866 3:134693921-134693943 CCCAGAACGTGAAGAGTGAGTGG - Intronic
962528262 3:136255122-136255144 CCCAGCACTTTGAGAGGCAGAGG - Intronic
962551003 3:136491740-136491762 CCCAGCACGTTGGGAGCCCGAGG + Intronic
962824465 3:139087959-139087981 CCCACAACATAGCGAGCAAGGGG + Intronic
963153297 3:142069857-142069879 CCCAGAACTTTGAGAGGCTGAGG - Intronic
963622662 3:147631739-147631761 CCCAGCACTTTGAGAGCCCGAGG - Intergenic
963633374 3:147762039-147762061 CCCAGAACTTTGGGAGGATGAGG + Intergenic
964108922 3:153068939-153068961 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
964291591 3:155186872-155186894 CCCAGAACTTTGGGATCACGAGG - Intergenic
964473289 3:157076622-157076644 CCCAGAACGTAGAGACCAGCAGG - Intergenic
964852731 3:161112462-161112484 CCCAGAACTTTGAGAGGCTGAGG + Intronic
965160243 3:165123937-165123959 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
965365456 3:167793485-167793507 CCCAGTACTTTGAGAGACAGAGG + Intronic
965392248 3:168119047-168119069 CCCAGAACTTTGGGAGGATGAGG - Intergenic
965588603 3:170341844-170341866 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
965840535 3:172900889-172900911 CCCAGCACTTTGGGAGGAAGAGG - Intronic
965927180 3:173995934-173995956 CCCAGCACTTTCAGAGGAAGAGG - Intronic
966164088 3:176997739-176997761 CCCAGCACTTTGAGAGGATGAGG - Intergenic
966203230 3:177378754-177378776 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
966817194 3:183899021-183899043 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
966850647 3:184163136-184163158 CCCAGAACTTTGAGAGGCTGAGG - Intronic
967058810 3:185853404-185853426 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
967169855 3:186814619-186814641 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
967182490 3:186918613-186918635 CCCAGAACTTTGGGAGGCAGGGG - Intergenic
967254609 3:187576959-187576981 GCCACAATGTTGACAGCAAGTGG + Intergenic
967309567 3:188093370-188093392 CCCAGAACTTTGAGAGGCGGAGG - Intergenic
967608345 3:191475104-191475126 CCCAGCACTTTGAGAGACAGTGG + Intergenic
967889502 3:194355043-194355065 CCCAGCACGTTGAGAGGCCGAGG - Intergenic
967909254 3:194527718-194527740 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
968095850 3:195930247-195930269 CCCAGAACTTTGGGAGACAGAGG - Intergenic
1202744543 3_GL000221v1_random:87013-87035 CCCACAATGTGGCGAGCAAGGGG + Intergenic
968742593 4:2339060-2339082 CCCAGCACGTTGAGAGGCCGAGG - Intronic
968849517 4:3069404-3069426 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
969888901 4:10241434-10241456 CCCAGAACATCGAGAGATAGTGG + Intergenic
969940938 4:10730633-10730655 CCCAGCACGTTGAGATCAAAGGG + Intergenic
970034141 4:11712885-11712907 CCCAGAACTTTGGGAGCCCGAGG + Intergenic
970218976 4:13787813-13787835 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
970478819 4:16452223-16452245 CCCAGCACTTTGAGAGTCAGAGG - Intergenic
970569258 4:17363704-17363726 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
970609268 4:17710073-17710095 CCCAGCACTTTGAGAGGCAGAGG + Intronic
970642015 4:18077066-18077088 CCCAGCACTTTGAGAGCCCGAGG - Intergenic
970936196 4:21572875-21572897 CCCAGCACTTTGGGAGCCAGAGG - Intronic
971467913 4:26984613-26984635 CCCAGCACTTTGGGAGCCAGAGG - Intronic
971560532 4:28074306-28074328 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
971693564 4:29868964-29868986 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
972529891 4:39952077-39952099 CCCAGAACTTTGGGAGGCAGAGG + Intronic
972852440 4:43067785-43067807 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
973018401 4:45169882-45169904 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
973893986 4:55394611-55394633 CCCAGCACTTTGAGAGGACGAGG + Intergenic
974129568 4:57737014-57737036 TCCACAAAGTGGAGAGCAAGAGG + Intergenic
974210020 4:58759903-58759925 CCCAGCACTTTGAGAGGACGAGG - Intergenic
974508148 4:62804163-62804185 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
974559493 4:63498633-63498655 CCCAGAACTTTGAGAGGCAGTGG + Intergenic
974613111 4:64241914-64241936 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
974961633 4:68709367-68709389 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
975776174 4:77789698-77789720 CCCAGAACTTTGGGAGGCAGAGG + Intronic
975977984 4:80121015-80121037 CCCAGCACTTTGGGAGGAAGGGG + Intronic
976288139 4:83389987-83390009 CCCAGAACGTTGGGAGGGTGAGG - Intergenic
976418651 4:84811247-84811269 CCCAGCACTTTGAGAGGCAGAGG - Intronic
976472472 4:85445768-85445790 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
976588875 4:86829158-86829180 CCCAGAACTTTGGGAGGCAGAGG + Intronic
976600243 4:86931647-86931669 CCCAGCACGTTGGGAGGATGAGG - Intronic
976734462 4:88296141-88296163 CCCACAACGTTGTGAGCAAGGGG + Intergenic
976874119 4:89833725-89833747 CCCAGCACTTTGAGAGCCCGAGG - Intronic
977412486 4:96685899-96685921 CCCAGAACGCTGAGAGGCCGAGG + Intergenic
977530735 4:98197960-98197982 CCCAGAACAGTAAGAGAAAGAGG - Intergenic
977645859 4:99410616-99410638 CCCACAACATGGTGAGCAAGGGG + Intergenic
977746129 4:100549668-100549690 CCCAGAACTTTGAGAGGCTGAGG - Intronic
977752039 4:100621075-100621097 CCCAGAACTTTGGGAGGCAGAGG - Intronic
978257460 4:106709742-106709764 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
979265889 4:118702523-118702545 CCCAGCACTTTGAGAGACAGAGG + Intronic
980297076 4:130934754-130934776 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
980309897 4:131113138-131113160 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
980533055 4:134079218-134079240 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
980647207 4:135657275-135657297 CTCAGAACTTTGGGAGGAAGAGG + Intergenic
980730888 4:136823477-136823499 CCCACAACGTGGTGAGCAAGGGG + Intergenic
980937332 4:139238476-139238498 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
981003768 4:139854071-139854093 CCCAGCACTTTGAGAGGACGAGG - Intronic
981313810 4:143322231-143322253 CCCAGCACTTTGAGAGGATGGGG - Intergenic
981498934 4:145425727-145425749 CCCAGCACGTTGGGAGCCGGAGG + Intergenic
981732995 4:147919828-147919850 CCCAGCACTTTGAGAGGCAGAGG - Intronic
981801500 4:148662646-148662668 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
982272078 4:153600858-153600880 CCCAGCACTTTGGGAGCATGAGG + Intronic
982757369 4:159237746-159237768 CCCAGAACTTTGGGAGGCAGAGG + Intronic
982902373 4:161023317-161023339 CCCAGCACGTTGAGAGGCGGAGG - Intergenic
983491988 4:168399204-168399226 CCCATAACGTGGCAAGCAAGGGG - Intronic
983589523 4:169392285-169392307 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
983633467 4:169873926-169873948 CCCAGCACTTTGGGAGCCAGAGG - Intergenic
984469660 4:180152201-180152223 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
984488110 4:180398349-180398371 CCCACCACGTTGAGAGACAGTGG - Intergenic
984515487 4:180733734-180733756 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
984540867 4:181035479-181035501 CCCAGCACGTTGAGAGGCAGAGG + Intergenic
984566418 4:181336500-181336522 ACCAGAATGTTGTTAGCAAGTGG + Intergenic
984746513 4:183224809-183224831 CCCAGAACTTTGAGAGGCTGAGG - Intronic
984766772 4:183405960-183405982 CCCAGAACTTTGGGAGGAAGAGG + Intergenic
984795349 4:183655189-183655211 CCCAGAACTTTGAGAGGCCGAGG - Intronic
984819130 4:183864642-183864664 CCCAGCACGTTGGGAGGCAGAGG - Intronic
984891155 4:184494591-184494613 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
985050296 4:185983984-185984006 CCCAGAACTTTGGGAGCCCGAGG - Intergenic
985255795 4:188068850-188068872 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
985305137 4:188531301-188531323 CCCAGAACTTTGGGAGGACGAGG + Intergenic
986103391 5:4635252-4635274 CCCAGAATTCTGAAAGCAAGAGG - Intergenic
986436380 5:7735945-7735967 CCCAGCACTTTGAGAGGCAGAGG + Intronic
987161503 5:15148921-15148943 TCCAGAAACTTGAGGGCAAGAGG + Intergenic
987798049 5:22654879-22654901 CCCAGCACGTTGAGAGGCTGAGG - Intronic
988073699 5:26325684-26325706 CCCACAACGTGGCAAGCAAGGGG + Intergenic
988115019 5:26875715-26875737 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
988152075 5:27397064-27397086 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
988339132 5:29946721-29946743 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
988346409 5:30042633-30042655 CCCACAACGTGGTGAGCAAGGGG - Intergenic
988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG + Intronic
988960310 5:36364296-36364318 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
989066979 5:37473592-37473614 CCCAGCACGTTGGGAGGCAGAGG - Intronic
989265175 5:39464871-39464893 CCCAGCACGTTGGGAGGCAGAGG + Intergenic
989592564 5:43125407-43125429 CCCAGCACTTTGGGAGGAAGAGG - Intronic
989761481 5:45021725-45021747 CCCAGCACTTTGAGAGGATGAGG + Intergenic
990895020 5:60689789-60689811 CCCAGCACTTTGAGAGGATGAGG + Intronic
991091239 5:62695944-62695966 CCCAGAACTTTGGGAGCCCGAGG - Intergenic
991141091 5:63243914-63243936 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
991560722 5:67948697-67948719 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
992076510 5:73197262-73197284 TTCAGAACGTTGAGAAAAAGTGG + Intergenic
992260009 5:74960022-74960044 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
992708969 5:79429771-79429793 CCCAGCACTTTGGGAGGAAGAGG + Intronic
992822256 5:80509227-80509249 CCCAGCACTTTGGGAGCCAGAGG - Intronic
992865500 5:80953345-80953367 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
992914531 5:81434405-81434427 CCCAGAACTTTGAGAGGCCGAGG + Intronic
992993236 5:82306773-82306795 CCCAGCACTTTGAGAGAACGAGG - Intronic
993188320 5:84648232-84648254 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
993300304 5:86200733-86200755 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
993423179 5:87728455-87728477 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
993576049 5:89602123-89602145 CCCAGAACGTTGGGAGGCCGAGG - Intergenic
994692305 5:103034140-103034162 CCCACAACGTGGTAAGCAAGGGG + Intergenic
995163001 5:109003727-109003749 CCCAGCACTTTGGGAGCTAGAGG + Intronic
995264921 5:110148165-110148187 CCCAGAACTTTGAGAGCCTGAGG + Intergenic
996294750 5:121898398-121898420 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
996592055 5:125159048-125159070 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
996819451 5:127610098-127610120 CCCAGCACATTGAGAGGCAGAGG - Intergenic
997308311 5:132857121-132857143 CCCAGCACTTTGGGAGCCAGAGG - Intergenic
997545583 5:134704316-134704338 CCCAGCACGTTGGGAGGCAGAGG - Intronic
997555725 5:134796899-134796921 CCCAGAACTTTGAGAGGCTGAGG + Intronic
997813499 5:136994760-136994782 CCCAGCACTTTGAGAGGCAGTGG + Intronic
997900679 5:137761071-137761093 CCCAGTACTTTGGGAGCCAGAGG - Intergenic
997928111 5:138049521-138049543 CCCAGCACTTTGGGAGGAAGAGG - Intronic
998020440 5:138765430-138765452 CCCAGCACATTGGGAGGAAGAGG - Intronic
998084293 5:139304256-139304278 CCCAGCACTTTGAGAGGACGAGG + Intronic
998325973 5:141280173-141280195 CCCAGCACTTTGGGAGCATGAGG + Intergenic
998572096 5:143270385-143270407 CCCAGAACTTTGGGAGACAGAGG - Intergenic
998725371 5:145006752-145006774 CCCAGCACTTTGAGAGGCAGCGG - Intergenic
999158147 5:149473182-149473204 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
999170598 5:149590847-149590869 CCCAGAACTTTGGGAGGACGAGG - Intronic
999210354 5:149882805-149882827 CCCAGCACTTTGAGAGACAGAGG + Intronic
1000876369 5:166643383-166643405 CCCAGCACGTTGGGAGCCTGAGG - Intergenic
1000896799 5:166865167-166865189 GCCAGAAAGTTGAGAGTCAGGGG + Intergenic
1001063345 5:168513567-168513589 CCCAGCACTTTGAGAGCCTGAGG - Intronic
1001343768 5:170871295-170871317 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1001388575 5:171359980-171360002 GGCAGAACGTTGAGTGAAAGGGG - Intergenic
1001532753 5:172475983-172476005 CCCAGCACGTTGAGAGGCTGAGG + Intergenic
1002107232 5:176885984-176886006 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1002311000 5:178313732-178313754 CCCAGAACTTTGGGAGGAAGTGG + Intronic
1002485534 5:179533409-179533431 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1002584215 5:180231617-180231639 CCCAGCACTTTGAGAGGACGAGG + Intergenic
1002842219 6:915913-915935 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1002983228 6:2162857-2162879 CCCAGAGCTTGGAGAGCAGGAGG - Intronic
1003110096 6:3246144-3246166 CCCAGCACTTTGGGAGCCAGGGG - Intronic
1003142171 6:3480823-3480845 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1003526503 6:6902373-6902395 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1003567484 6:7232839-7232861 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1003589417 6:7424713-7424735 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1003645059 6:7908032-7908054 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1004123014 6:12844142-12844164 CCCAGCACATTGAGAGCCTGAGG + Intronic
1004578188 6:16920375-16920397 CCCAGCACTTTGGGAGCAGGAGG + Intergenic
1004649029 6:17590756-17590778 CCCAGAACGTTGGGAGGCTGAGG + Intergenic
1004666298 6:17751303-17751325 CCCAGCACTTTGGGAGCACGAGG - Intergenic
1004688899 6:17975091-17975113 CCCAGAACTTTGAGAGAAAGAGG + Intronic
1004920508 6:20371283-20371305 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1004930996 6:20463168-20463190 CCCAGAATTTTGAGAGGCAGAGG - Intronic
1005022144 6:21428510-21428532 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1005585418 6:27271938-27271960 CCCAGCACGTTGAGAGGCCGAGG - Intergenic
1005673545 6:28131264-28131286 CCCAGCACTTTGAGAGGATGAGG - Intergenic
1005775267 6:29124520-29124542 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1006012998 6:31057860-31057882 CCCAAAACGTTGAAAGAAACTGG - Intergenic
1006752138 6:36385223-36385245 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1006867208 6:37218425-37218447 CCCAGTACTTTGAGAGGCAGAGG - Exonic
1006891786 6:37434860-37434882 CCCAGCACTTTGGGAGAAAGAGG - Intronic
1007059134 6:38921130-38921152 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1007160123 6:39784414-39784436 CCCAGCACGTTGGGAGGCAGAGG - Intergenic
1007553859 6:42750111-42750133 CCCAGAACCTTGGGAGGCAGAGG - Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1007794831 6:44339094-44339116 CCCAGACCCTTGAGAGCAGCTGG - Intronic
1007831767 6:44644298-44644320 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
1008005259 6:46403320-46403342 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1008033976 6:46726890-46726912 CCCAGCACTTTGAGAGGTAGAGG - Intronic
1008609993 6:53176838-53176860 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1008852941 6:56046843-56046865 CCCAGAACTTTGGGAGCCTGAGG + Intergenic
1009003569 6:57751399-57751421 CCCAGCACGTTGGGAGGCAGAGG + Intergenic
1009439199 6:63655891-63655913 CCCAGAACTTTGAGAGGACAAGG - Intronic
1009646210 6:66405046-66405068 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1009971804 6:70632655-70632677 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1010412167 6:75573009-75573031 CCCAGAACTTTGGGAGCCTGAGG + Intergenic
1011127445 6:84022297-84022319 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1011195840 6:84778500-84778522 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1011459405 6:87588022-87588044 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1011530072 6:88312022-88312044 CCCACAACATGGTGAGCAAGGGG + Intergenic
1011602108 6:89069557-89069579 CCCAGAACTTTGGGAGGATGTGG + Intergenic
1012068972 6:94587386-94587408 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1012103533 6:95123348-95123370 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1012231117 6:96762226-96762248 CCCACAACGTGGTGAGCAAGGGG + Intergenic
1012555924 6:100511479-100511501 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1012887897 6:104865735-104865757 CCCAGCACGTTGGGAGCCTGAGG + Intergenic
1012906850 6:105076977-105076999 CCCAGCACTTTGGGAGGAAGGGG + Intronic
1013096252 6:106947987-106948009 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1013180773 6:107715223-107715245 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1013215342 6:108022280-108022302 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1013724870 6:113081939-113081961 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1013899342 6:115134319-115134341 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1014425471 6:121300191-121300213 CCCAGCACTTTGAGAGGATGAGG + Intronic
1014458968 6:121672374-121672396 CCCAGCACTTTGAGAGGCAGGGG + Intergenic
1014546180 6:122739219-122739241 CCCAGAACTTTGAAAGGCAGAGG + Intergenic
1014549425 6:122772667-122772689 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1015138743 6:129905572-129905594 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1015193295 6:130496165-130496187 CCCAGAACGTTGGGAGGCTGAGG + Intergenic
1016154491 6:140786792-140786814 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1016390286 6:143567647-143567669 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1016408273 6:143754914-143754936 CCCAGATCCTTGAGAGCGAAAGG + Intronic
1016812275 6:148273007-148273029 CCCAGAACTTTGAGAGGCCGGGG + Intronic
1016950261 6:149572914-149572936 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1017115187 6:150969230-150969252 CCCAGTACTTTGAGAGGCAGAGG - Intronic
1017257142 6:152346558-152346580 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1017491414 6:154948847-154948869 CCCAGCACTTTGAGAGGACGAGG - Intronic
1017543880 6:155430382-155430404 ACCATAAGGTTCAGAGCAAGAGG - Intronic
1017551409 6:155512446-155512468 CCCAGAACTTTCAGAGGACGTGG - Intergenic
1017825381 6:158077846-158077868 CCCAGAAGGTTGGCAGCAATTGG - Intronic
1018210986 6:161481352-161481374 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1018271028 6:162077747-162077769 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1018659909 6:166076441-166076463 CCCACAACATGGCGAGCAAGGGG + Intergenic
1019535612 7:1528269-1528291 CCCAACACGTTGAGAGGACGAGG + Intergenic
1019995169 7:4719388-4719410 CCCAGCACGTTGGGAGGCAGAGG - Intronic
1020072945 7:5239503-5239525 CCCAGCACTTTGAGAGCCCGAGG + Intergenic
1020183983 7:5944706-5944728 CCCAGAACTTTGAGAGGCTGAGG + Intronic
1020193616 7:6019771-6019793 CCCAGAACTTTGGGAGAACGAGG + Intronic
1020202661 7:6092427-6092449 CCCAGAACTTTGAGAGCCCAAGG - Intergenic
1020255527 7:6501098-6501120 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1020298935 7:6780071-6780093 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1020438760 7:8195280-8195302 CCCAGCACTTTGAGAGGATGAGG + Intronic
1020793304 7:12652851-12652873 CCCAGCACTTTGAGAGGATGAGG + Exonic
1021043469 7:15892222-15892244 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1021527582 7:21606071-21606093 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1021582583 7:22172372-22172394 CCCAGAACTTTGGGAGCCCGAGG - Intronic
1021636321 7:22697703-22697725 CCCAGAACTTTGGGAGCCCGAGG + Intergenic
1022337744 7:29437858-29437880 CCCAGAGGGGTCAGAGCAAGAGG + Intronic
1022597261 7:31724510-31724532 CCCATAAGGTTGACAGCAGGTGG - Intergenic
1022723204 7:32958543-32958565 CCCAGCACTTTGAGAGAACGAGG + Intronic
1023133143 7:37023832-37023854 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1023305458 7:38821450-38821472 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1023376534 7:39561682-39561704 CCCAGCACGTTGAGAGGCCGAGG + Intergenic
1023427645 7:40055830-40055852 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1023514047 7:40982897-40982919 CCCAGAACGTTGGGAGGCTGAGG - Intergenic
1023857221 7:44192052-44192074 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1024011065 7:45267191-45267213 CCCAGAGAGTTGAGAACATGTGG - Intergenic
1024450713 7:49539684-49539706 CCCAGGACTTTGGGAGCATGAGG + Intergenic
1025535941 7:61947989-61948011 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
1025720023 7:64001025-64001047 CCCAGAACGTTGGGAGGCTGAGG - Intergenic
1025789529 7:64676100-64676122 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1025949425 7:66132009-66132031 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1025949915 7:66136478-66136500 CCCAGAACTTTGAGAGGTCGAGG - Intronic
1026172724 7:67968518-67968540 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1026203879 7:68238673-68238695 CCCAGCACTTTGAGAGACAGAGG + Intergenic
1026232859 7:68500392-68500414 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1026290524 7:69001844-69001866 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1026536237 7:71240912-71240934 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1026553929 7:71390160-71390182 CCCAGCACGATGAAAGGAAGGGG - Intronic
1026649064 7:72199022-72199044 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1026690740 7:72548084-72548106 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1026748535 7:73031575-73031597 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1026752183 7:73059720-73059742 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1026755834 7:73087847-73087869 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1026782361 7:73277429-73277451 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
1027023123 7:74830250-74830272 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1027034737 7:74916881-74916903 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1027064806 7:75115046-75115068 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1027091566 7:75305543-75305565 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1027095209 7:75333509-75333531 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1027132758 7:75603094-75603116 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1027193895 7:76014994-76015016 CCCAGAACCTTGGGAGGCAGAGG + Intronic
1027221171 7:76214857-76214879 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1027324129 7:77034160-77034182 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1027449170 7:78310184-78310206 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1027575254 7:79922810-79922832 CCCACAATGTGGCGAGCAAGCGG - Intergenic
1027749026 7:82117533-82117555 CCCAGCACTTTGGGAGGAAGAGG + Intronic
1027760098 7:82266765-82266787 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1028024660 7:85821866-85821888 CCCACAACATGGTGAGCAAGGGG - Intergenic
1028570228 7:92278596-92278618 CCCAAAAGGTTGAGTGCAAGAGG + Intronic
1028571445 7:92291823-92291845 CCCAGAACTTTGGGAGCCTGAGG - Intronic
1029087945 7:98025937-98025959 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1029194643 7:98796779-98796801 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1029240855 7:99161110-99161132 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1029384791 7:100236508-100236530 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1029563640 7:101320750-101320772 CCCAGAACTTTGAGAGACTGAGG + Intronic
1029635518 7:101781113-101781135 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1029688095 7:102162764-102162786 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1029722477 7:102378118-102378140 CCCAGCACTTTGAGAGGATGAGG - Intronic
1029939893 7:104468907-104468929 CCCAGCACTTTGGGAGGAAGAGG - Intronic
1030091746 7:105864203-105864225 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1030111038 7:106027144-106027166 CCCAGCACTTTGAGAGGACGAGG + Intronic
1030609129 7:111669651-111669673 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1030935234 7:115577798-115577820 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1031111897 7:117620854-117620876 CCCAGCACTTTGAGAGCCTGGGG + Intronic
1031389738 7:121199427-121199449 CCCAGCACGTTGGGAGGCAGAGG + Intronic
1031836523 7:126686366-126686388 CCCACAACGTGGCAAGCAAGGGG - Intronic
1032041593 7:128567470-128567492 CCCAACACTTTGAGAGCATGAGG - Intergenic
1032212341 7:129927289-129927311 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1032736481 7:134696915-134696937 CCCAGCACTTTGAGAGCCCGAGG - Intergenic
1033078427 7:138271044-138271066 CCCAGCACTTTGAGAGGATGAGG + Intergenic
1033309294 7:140248539-140248561 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1033396971 7:140984338-140984360 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1033760086 7:144428212-144428234 CCCAAAATGTTGATAGCAATAGG - Intergenic
1033785207 7:144721890-144721912 CCCAGCACGTTGAGAGGCTGAGG - Intronic
1034204393 7:149302935-149302957 CCCTGCACTTTGGGAGCAAGAGG - Intergenic
1034481326 7:151322122-151322144 CCCACAATGTGGCGAGCAAGGGG - Intergenic
1034991888 7:155552912-155552934 CCCAGAACTTTGAGAGGTCGAGG + Intergenic
1035813438 8:2513093-2513115 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1035822632 8:2610726-2610748 ACCAGGAGGTAGAGAGCAAGTGG - Intergenic
1035875180 8:3180892-3180914 CCCAGCACGTTGGGAGGAAGAGG - Intronic
1036440167 8:8774761-8774783 CCCAGAACTTTGGGAGCTTGAGG - Intergenic
1036720658 8:11172118-11172140 CCCAGCACGTTGGGAGCCTGAGG + Intronic
1037217878 8:16479949-16479971 CCCAGCACTTTGAGAGGAAGAGG - Intronic
1037345296 8:17892947-17892969 CCCAGCACGTTGAGAGGCTGAGG + Intronic
1037495469 8:19436654-19436676 CCCAGAACTTTGGGAGGATGAGG + Intronic
1037518323 8:19655666-19655688 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1037809832 8:22080800-22080822 CCCAGAACGGAGAGGGCCAGAGG + Exonic
1037983138 8:23269487-23269509 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1038013297 8:23492251-23492273 CCCAGAACTTTGGGAGGATGAGG + Intergenic
1038163960 8:25067062-25067084 CCCAGAACAGTCACAGCAAGTGG + Intergenic
1038394597 8:27237503-27237525 CCCAGCACGTTGGGAGACAGAGG - Intronic
1038517011 8:28195881-28195903 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1038702073 8:29858075-29858097 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1038723700 8:30060487-30060509 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1039048430 8:33471498-33471520 CCCAGAACTTTGAGAGACCGAGG - Intronic
1039252513 8:35682211-35682233 CCCAGCACGTTGAGAGGCCGAGG - Intronic
1039468420 8:37799124-37799146 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1039704582 8:39993757-39993779 CCCAGCACACTGAGAGGAAGAGG + Intronic
1039809871 8:41037134-41037156 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1040067961 8:43163764-43163786 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1040073234 8:43205066-43205088 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1040508092 8:48069684-48069706 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1040888203 8:52288447-52288469 CCCAGCACTTTGAGAGACAGAGG + Intronic
1040903524 8:52441414-52441436 CCCAAAACTTTGAGAGGCAGAGG + Intronic
1041006995 8:53505076-53505098 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1041043124 8:53866630-53866652 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1041242513 8:55860100-55860122 CCCAGAACGTTGGGAGGCTGAGG + Intergenic
1041447309 8:57966587-57966609 CCCAGCACTTTGGGAGCATGAGG + Intergenic
1041568865 8:59313161-59313183 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
1041922312 8:63196041-63196063 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1041996700 8:64070181-64070203 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1042336976 8:67639693-67639715 CCCACAACGTGGTGAGCAAGGGG + Intronic
1042572172 8:70177471-70177493 CCCAGAAGCATGGGAGCAAGTGG + Intronic
1042592097 8:70405495-70405517 CCCAAAGCGTTGAGAGGAAATGG + Intergenic
1043574920 8:81645972-81645994 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1043576647 8:81666621-81666643 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1044005873 8:86936488-86936510 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1044245558 8:89940365-89940387 CCCAGCACTTTGGGAGCAGGAGG - Intronic
1044975950 8:97665874-97665896 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1045041048 8:98225005-98225027 CCCAGAACTTTGAGTGGCAGAGG - Intronic
1045096937 8:98807506-98807528 CCCAGTACTTTGGGAGCCAGAGG - Intronic
1045352037 8:101350705-101350727 CCCAGCACTTTGAGAGGACGAGG + Intergenic
1045360161 8:101425512-101425534 CCCAGAACGTTGGGAGACTGAGG + Intergenic
1045915615 8:107466659-107466681 CCCAGCACTTTGGGAGAAAGAGG + Intronic
1046852195 8:118987311-118987333 CCCAGAACTTTGAGAGGCTGAGG + Intergenic
1046907381 8:119588277-119588299 CCCAGCACTTTGAGAGGCAGGGG + Intronic
1046914420 8:119664689-119664711 CCCAGCACTTTGGGAGAAAGAGG + Intronic
1047538102 8:125737687-125737709 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1047575920 8:126155205-126155227 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
1047749499 8:127869379-127869401 CCCAGCACTTTGAGAGGAGGAGG - Intergenic
1048264071 8:132970147-132970169 CTCAGAATCTGGAGAGCAAGTGG + Intronic
1048421632 8:134283569-134283591 CCCACAATGTGGTGAGCAAGGGG + Intergenic
1048487643 8:134863470-134863492 TCCAGAAGGCAGAGAGCAAGTGG - Intergenic
1049117021 8:140697654-140697676 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1049248584 8:141576157-141576179 CCCAGAACTTTGAGGGCTGGGGG - Intergenic
1050168949 9:2795623-2795645 CCCAGAACGTTGGGAGGCCGAGG + Intronic
1050233405 9:3552803-3552825 CCCAGCACGTTGGGAGCCTGAGG - Intergenic
1050514464 9:6428797-6428819 CCCAGCACTTTGGGAGGAAGTGG - Intronic
1051414121 9:16820980-16821002 CCCAGAACGTTGGGAGGCCGAGG + Intronic
1051948949 9:22607440-22607462 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1052051839 9:23858068-23858090 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1052062681 9:23980063-23980085 CCCAAAACCTTGAGGGTAAGAGG - Intergenic
1052107206 9:24533672-24533694 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1052132358 9:24863988-24864010 CCCAGAACTTTGAGAGGCCGAGG + Intergenic
1052460725 9:28759430-28759452 CCCAGAACTTTGGGAGGACGAGG + Intergenic
1052570349 9:30213651-30213673 CCCAGAACTTTGGGAGCCTGAGG + Intergenic
1052673871 9:31594107-31594129 CCCAGCACGTTGAGAGGCCGAGG - Intergenic
1052918384 9:33942061-33942083 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1052936734 9:34099480-34099502 CCCAGAACGTTGAGAGGCTGAGG - Intronic
1053318802 9:37077122-37077144 CCCAGCACTTTGGGAGGAAGAGG + Intergenic
1053710156 9:40799102-40799124 CCAAGCAAGATGAGAGCAAGTGG + Intergenic
1054420060 9:64919897-64919919 CCAAGCAAGATGAGAGCAAGTGG + Intergenic
1055056975 9:72032802-72032824 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1055060986 9:72068543-72068565 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1055091732 9:72370190-72370212 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1055109813 9:72548733-72548755 CCCAGAACTTTGAGAGGGCGAGG + Intronic
1055284563 9:74714705-74714727 CCCAGCACTTTGAGAGGACGAGG + Intergenic
1055457740 9:76488732-76488754 CCCAGAACTTTGGGAGGACGAGG - Intronic
1055552873 9:77447192-77447214 CCCAGCACTTTGAGAGGACGAGG - Intronic
1055774713 9:79754915-79754937 CCCAGCACTTTGAGAGCTCGAGG - Intergenic
1055967169 9:81876830-81876852 CCCAGCACTTTGAGAGGACGAGG + Intergenic
1056309420 9:85323820-85323842 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1056414148 9:86360073-86360095 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1056542513 9:87584925-87584947 CCCAGAACTTTGAGAGGCCGAGG - Intronic
1056690250 9:88802203-88802225 TCCAGAAAGTTGAGAAGAAGAGG + Intergenic
1056782015 9:89557505-89557527 CCCAGCACTTTGAGAGGACGAGG - Intergenic
1057156219 9:92842316-92842338 CCCAGAACTTTGGGAGGATGAGG + Intergenic
1057496990 9:95569208-95569230 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
1057595924 9:96416334-96416356 CCCAGAACTTTGCGAGGCAGAGG - Intronic
1058032725 9:100217056-100217078 CCCAGAACGTTGAGAGGCCGAGG + Intronic
1058077755 9:100667946-100667968 CCCACAATGTAGTGAGCAAGGGG - Intergenic
1058243163 9:102592950-102592972 CCCAGAACTTTGAGAGGCAGAGG + Intergenic
1058406126 9:104676270-104676292 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1058736390 9:107898059-107898081 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1058986480 9:110212695-110212717 TCTAGAAAGTAGAGAGCAAGGGG - Intergenic
1059183771 9:112245927-112245949 CCCAGCACTTTGAGAGGATGAGG - Intronic
1059235154 9:112754654-112754676 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1059369221 9:113811935-113811957 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1059764104 9:117367021-117367043 CCCAGAACTTTGAGAGGCTGAGG - Intronic
1059770605 9:117420555-117420577 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1060014540 9:120075245-120075267 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1060294487 9:122333919-122333941 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
1060353712 9:122883729-122883751 CCCAGCACGTTGAGAGGCCGAGG + Intronic
1060613010 9:124985615-124985637 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1060618864 9:125044695-125044717 CCTACAACGTGGCGAGCAAGGGG - Intronic
1060651978 9:125335900-125335922 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1060693935 9:125689834-125689856 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1060695201 9:125703519-125703541 CCCAGCACTTTGAGAGCCCGAGG + Intronic
1061018854 9:128000713-128000735 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1061076767 9:128346149-128346171 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1061139513 9:128756195-128756217 CCCAGAACTTTGAGAGGCCGAGG + Intronic
1061139609 9:128757266-128757288 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1061241555 9:129377146-129377168 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1061522411 9:131126798-131126820 CCCAGCACTTTGGGAGCCAGAGG - Intronic
1061539295 9:131268947-131268969 CCCAGCACTTTGGGAGCCAGAGG + Intronic
1061598440 9:131648137-131648159 CCCAGCACTTTGAGAGGATGAGG + Intronic
1061740752 9:132704002-132704024 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1062169314 9:135126096-135126118 CCCAGCACGTTGGGAGCCCGAGG - Intergenic
1062329187 9:136029526-136029548 CCCACAACGTGGTGGGCAAGGGG - Intronic
1062603913 9:137334250-137334272 CCCAGGACTTTGAGAGGCAGAGG - Intronic
1202801619 9_KI270720v1_random:4526-4548 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1203688837 Un_GL000214v1:23290-23312 CCCACAATGTGGTGAGCAAGGGG - Intergenic
1203448748 Un_GL000219v1:89319-89341 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1203713173 Un_KI270742v1:116962-116984 CCCACAATGTGGCGAGCAAGGGG + Intergenic
1203647438 Un_KI270751v1:80763-80785 CCCACAATGTGGTGAGCAAGGGG + Intergenic
1185453622 X:296371-296393 CCCAGCACGTTGAGAGGTTGAGG - Intronic
1185575675 X:1170333-1170355 CCCAGCACTTTGAGAGGAAGGGG - Intergenic
1185768688 X:2748128-2748150 CCCAGGACTTTGAGAGCCAGAGG - Intergenic
1186367644 X:8912108-8912130 CCCAGCACTTTGGGAGGAAGAGG - Intergenic
1186414912 X:9374697-9374719 CCCAGCACGTTGAGAGGCTGAGG - Intergenic
1186668954 X:11749539-11749561 CCGAGAGGGTTGAGAGAAAGCGG + Intergenic
1186945249 X:14559073-14559095 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1187131623 X:16508862-16508884 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1187155353 X:16716113-16716135 CCCAGAACTTTGAGAGGCCGAGG - Intergenic
1187721692 X:22157239-22157261 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1188991172 X:36822493-36822515 CCCAGAACTTTGGGAGACAGAGG - Intergenic
1189107114 X:38248502-38248524 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1189230873 X:39451380-39451402 CCCGGCATGTTCAGAGCAAGGGG + Intergenic
1189467014 X:41285180-41285202 CCCAAAACGTTGGGAGGCAGAGG + Intergenic
1189771281 X:44430125-44430147 CCCAACACTTTGAGAGCCAGAGG - Intergenic
1190025965 X:46923485-46923507 CCCAGAAGGTTGAGAGGCTGAGG - Intronic
1190111747 X:47594279-47594301 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1190292978 X:49005253-49005275 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1190833877 X:54082657-54082679 CCCAGCACTTTGAGAGCCTGAGG - Intronic
1190882502 X:54502276-54502298 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1190883431 X:54510024-54510046 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1191059861 X:56283619-56283641 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1191660132 X:63641099-63641121 CCCAGAACTTTGGGAGGACGAGG + Intronic
1192398181 X:70806202-70806224 CCCAGCACGTTGAGAGACCGAGG + Intronic
1192465315 X:71351097-71351119 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1192472974 X:71415385-71415407 CCCAGCACTTTGAGAGGCAGAGG - Intronic
1192769489 X:74172407-74172429 CCCAGAACTTTGGGAGCCTGAGG - Intergenic
1193122962 X:77842574-77842596 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1193186538 X:78520033-78520055 CCCAGAACTTTGGGAGGACGAGG - Intergenic
1194053051 X:89096085-89096107 CCCAGCACTTTGAGAGGTAGAGG - Intergenic
1194113301 X:89865845-89865867 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1194201200 X:90954559-90954581 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1194509083 X:94770109-94770131 CCCAGCACGTTGAGAGGCCGAGG + Intergenic
1194709499 X:97217695-97217717 CCCAGAACTTTGGGAGGCAGAGG + Intronic
1196068749 X:111495756-111495778 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1196657385 X:118232540-118232562 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1196780494 X:119379382-119379404 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1196889835 X:120281309-120281331 CCCAGAACGTTGAGAGCAAGGGG - Intronic
1197342284 X:125288219-125288241 CCCTCAACGTGGTGAGCAAGGGG - Intergenic
1197972781 X:132132641-132132663 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1198094741 X:133367998-133368020 CCCAGCACTTTGAGAGGCAGAGG + Intronic
1198260746 X:134962698-134962720 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1198446727 X:136724738-136724760 CCCAGAACTTTGGGAGGCAGAGG - Intronic
1198501060 X:137247027-137247049 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1198794054 X:140377182-140377204 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1198849409 X:140950049-140950071 CCCAAAACTTTGAGAGGATGAGG - Intergenic
1198853041 X:140986195-140986217 CCCAGAACTTTGGGAGGCAGAGG - Intergenic
1199345208 X:146731045-146731067 CCCAGAACTTTGGGAGGATGAGG - Intergenic
1199377060 X:147125323-147125345 CCCAGCACTTTGGGAGCCAGAGG + Intergenic
1200252903 X:154563277-154563299 CCCAGAACTTTGAGAGACTGCGG - Intronic
1200264864 X:154641138-154641160 CCCAGAACTTTGAGAGACTGCGG + Intergenic
1200414291 Y:2891716-2891738 CCCAGCACTTTGAGAGGAAGGGG + Intronic
1200465987 Y:3520920-3520942 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1200800630 Y:7384082-7384104 CCCAGAACGTTGGGAGCCTGAGG + Intergenic
1201145509 Y:11063064-11063086 CCCAGCACTTTGAGAGCCTGAGG + Intergenic
1201449342 Y:14094183-14094205 CCCAGAACTTTGAGAGGCTGAGG - Intergenic
1201608251 Y:15811468-15811490 CCCAGAACTTTGGGAGGCAGAGG + Intergenic
1202276150 Y:23122165-23122187 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1202289878 Y:23298526-23298548 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1202429143 Y:24755887-24755909 CCCAGCACTTTGAGAGGCAGAGG + Intergenic
1202441648 Y:24914202-24914224 CCCAGCACTTTGAGAGGCAGAGG - Intergenic
1202626237 Y:56862074-56862096 CCCAGCACTTTGAGAGGAAAAGG - Intergenic