ID: 1196890820

View in Genome Browser
Species Human (GRCh38)
Location X:120289020-120289042
Sequence TTCACCCAAGTCAAAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196890820 Original CRISPR TTCACCCAAGTCAAAGGAAC AGG Intronic
902754090 1:18537679-18537701 TTCCCCCAAGGCAAAGGATCTGG - Intergenic
905263699 1:36736706-36736728 TTTACCCAAGCAAAATGAACTGG + Intergenic
908518243 1:64915429-64915451 GTCTCCAAAGTCACAGGAACTGG + Intronic
908550370 1:65202649-65202671 TTCATCCAATTCCCAGGAACTGG - Intronic
908570183 1:65401599-65401621 TTCACCCAGGTCAGGGAAACAGG + Intronic
909224209 1:72995758-72995780 TTCACCCAAGCCAAACTCACAGG - Intergenic
910284581 1:85539547-85539569 TTAACCGAAGTCAAAGGTACGGG - Intronic
914205440 1:145523161-145523183 TTAACCGAAGTCAAAGGTACGGG + Intergenic
917594884 1:176519215-176519237 TTCTCACAAGTCACATGAACAGG + Intronic
917772812 1:178298521-178298543 TTGACCCAAGTCACAGGAGTTGG + Intronic
924592663 1:245418296-245418318 TTGACCCAAGTGACAGAAACTGG - Intronic
1063257140 10:4340734-4340756 TTCCCCCAAGTCAATGTAATAGG + Intergenic
1066795110 10:39111641-39111663 TACAGCCAAATTAAAGGAACAGG + Intergenic
1067137373 10:43622944-43622966 GTTATCCAAGGCAAAGGAACTGG + Intergenic
1069341955 10:67421070-67421092 TTCACTAAAGTCTAGGGAACAGG + Intronic
1070724125 10:78776863-78776885 CACAGCCAAGTCAAAGAAACAGG - Intergenic
1071065678 10:81633000-81633022 GTCTCCAAAGTCATAGGAACTGG + Intergenic
1071424504 10:85535097-85535119 TTTACTCAAGTCACATGAACTGG + Intergenic
1074052632 10:109894092-109894114 TTCTCCCAAGCCAAAGGACCTGG + Intronic
1074513821 10:114145975-114145997 TTAGCCGAAGTAAAAGGAACAGG - Intronic
1075015699 10:118908683-118908705 TTCCCCAAAGTCAAAGACACTGG - Intergenic
1080302581 11:30800703-30800725 TTCAACCAAGTCAAAAGAGGAGG + Intergenic
1083700469 11:64474139-64474161 TTCTCCCCAGCCAAATGAACAGG - Intergenic
1083859370 11:65411784-65411806 GTCACCCAAGTCCAGGGAAGAGG - Exonic
1086135544 11:83440452-83440474 TACACACAAGTCAGAGGAAGAGG + Intergenic
1088916885 11:114234405-114234427 TCTACCCCAGTAAAAGGAACTGG + Intronic
1090268346 11:125369013-125369035 TTCACCCAAGACTAATGAATAGG + Intronic
1095464404 12:42475531-42475553 TTCACCAAAGAAAAAGGAATTGG - Intronic
1096240377 12:49956598-49956620 CTCACCCAAGACAAAGGCCCGGG - Exonic
1096878687 12:54649705-54649727 TTCACCAAGGTCCCAGGAACAGG - Intergenic
1097196401 12:57244458-57244480 TTCCCCCAAGGGAAAGGAAAAGG - Intronic
1097488056 12:60231042-60231064 TACATCCAAGTCAAAGAAAAAGG - Intergenic
1098236517 12:68423256-68423278 GACACCAAGGTCAAAGGAACTGG + Intergenic
1098589949 12:72199185-72199207 GTCACTCCAGTCAAAGGAAAGGG - Intronic
1099018209 12:77371022-77371044 ATCTCCTAATTCAAAGGAACTGG - Intergenic
1106030581 13:25998517-25998539 TTCTCTCCAGACAAAGGAACAGG - Intronic
1107484781 13:40815185-40815207 TTCACCAAGGTCAATGGAAAAGG + Intergenic
1109036014 13:57261183-57261205 TTCACCCAAGACACAAGACCAGG + Intergenic
1109584215 13:64376547-64376569 TTCACCCAGGACAATTGAACTGG + Intergenic
1109711003 13:66160372-66160394 TTCACCAAAGTAGAAGGAACAGG + Intergenic
1110628597 13:77679440-77679462 TGCACCAAAGTCCCAGGAACAGG - Intergenic
1112757866 13:102659243-102659265 TGCACCAAAGTCCATGGAACAGG + Intronic
1115250170 14:31336748-31336770 TTCACCGCAGTCAAATGAAATGG - Intronic
1115377197 14:32690286-32690308 TTCACCCAAGTGAAATCAATGGG - Intronic
1117222150 14:53617026-53617048 CTAACCTAAGGCAAAGGAACTGG + Intergenic
1117453353 14:55873558-55873580 TTCTACCAAGTAAAAGTAACAGG + Intergenic
1117493143 14:56272858-56272880 TACACCCAAGAGAACGGAACAGG - Intronic
1120052049 14:79877943-79877965 CAAACCCAAGTCAAAGAAACAGG - Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123197970 14:106635222-106635244 TCCACCCAAGTCACTGGACCTGG + Intergenic
1126219782 15:46199173-46199195 TTCAGCAAAATGAAAGGAACTGG - Intergenic
1127855773 15:62952634-62952656 TTCACCCAAGGCAAGTCAACCGG - Intergenic
1128320231 15:66688313-66688335 TTAATCCATGTCAAAGTAACTGG - Intergenic
1128911629 15:71520530-71520552 TTCTCCCAACTCAAAGGCAGTGG - Intronic
1129551427 15:76454123-76454145 ATAACCCAAGTGAAAGGAAGGGG - Intronic
1130096347 15:80859080-80859102 TTGACCCAAGTCAAAAAAAAGGG - Intronic
1130197063 15:81789755-81789777 TTCATCCCAGTCAGAGGAAATGG + Intergenic
1130832307 15:87613865-87613887 TTAAACCAAGTCAAAAGAAGGGG - Intergenic
1132110787 15:99100510-99100532 TTCACCAAAGTCCAAGAAGCAGG - Intronic
1132734392 16:1378354-1378376 TGCACCCAAGTCCCAGGATCAGG + Intronic
1134259684 16:12640946-12640968 TTCACCCAGGTCACGGGAAGGGG - Intergenic
1135183027 16:20291753-20291775 TTCTTCCAAGTCAAAGGGTCTGG + Intergenic
1141463128 16:84190051-84190073 TTCTTCCAAGTCAAAGGTTCTGG + Intergenic
1155378411 18:25188420-25188442 TTCACACACATCAAAGGAAAAGG - Intronic
1156346912 18:36265416-36265438 TTCACACCAGTAACAGGAACAGG + Intronic
1161897200 19:7091296-7091318 TTCACCCTAGTCAAGGGTAAAGG + Intergenic
1163238109 19:16041529-16041551 TTCTCCCTAGCCAAAGGACCAGG + Intergenic
1164898063 19:31894770-31894792 TCCACCCAGGTCAAATGAAATGG - Intergenic
1168399528 19:56077004-56077026 TTGCCCCAGGTAAAAGGAACAGG + Intergenic
929887931 2:45895018-45895040 TTCACTCAAAACAAACGAACGGG - Intronic
930406944 2:50970419-50970441 TTCACTCAAATCAAAGCATCTGG + Intronic
932012503 2:67992546-67992568 CTCACGCATGGCAAAGGAACTGG - Intergenic
933608813 2:84412859-84412881 TTCACCCAACTCAAGGCAATAGG - Intergenic
935978612 2:108604726-108604748 TTCATCCAACTCAGAGGAGCAGG - Intronic
936917797 2:117657773-117657795 TTCAGCAAAATCAAAGAAACAGG - Intergenic
938095065 2:128456211-128456233 TTCACCCAAAGCAAAGGGTCTGG - Intergenic
939037159 2:137147087-137147109 TAGACCCAAGTCAGAGGCACTGG - Intronic
940706977 2:157118239-157118261 TTCCTCCAATTCAGAGGAACTGG + Intergenic
941154513 2:161959749-161959771 TGCACCCAAGTGAAGGGAAAAGG + Intronic
946950408 2:224867997-224868019 TTGAGCCAAGTCAAGGAAACTGG + Intronic
947165469 2:227257287-227257309 CTCACCCAGGTCAGAGGCACAGG - Intronic
1168877743 20:1182833-1182855 TTCACCAAAAACAAATGAACAGG - Intronic
1170600601 20:17838662-17838684 TTAACCCAAGGCAAGGGAGCTGG - Intergenic
1170932683 20:20782980-20783002 TTCAGCCCAGTCACAGGAAGGGG - Intergenic
1171260578 20:23728392-23728414 TACAGCCAACTCAAAGGAAGGGG - Intergenic
1174577714 20:51548409-51548431 TGCATTCAAGTGAAAGGAACAGG - Intronic
1175932615 20:62499837-62499859 TTCCCCCAAGTTAAAGGTGCGGG + Intergenic
1176702061 21:10066453-10066475 ATCACCCAAGTCAGACAAACAGG - Intergenic
1178794530 21:35731741-35731763 TTCACCCCCGTCAAATGAACTGG + Intronic
1179672941 21:42962537-42962559 TTCTCCCATGTAAAAGGAGCTGG + Intergenic
1181535652 22:23541777-23541799 TTCCCCCAAGTTAATGGAATGGG - Intergenic
949395624 3:3612042-3612064 TCCTCCCAAGTCAAAGGACCGGG + Intergenic
950773299 3:15329491-15329513 TTCACGCAACTCAGAGCAACAGG + Intronic
950929602 3:16775106-16775128 TTCCCCCAAGACACAGCAACGGG + Intergenic
951943669 3:28110560-28110582 TCAACCCAAGTAAAAGGAAAGGG + Intergenic
953304826 3:41818759-41818781 TTCACCCAAGGCAAAGCCATAGG - Intronic
953962179 3:47274582-47274604 TTAACCCAACACAAATGAACAGG + Intronic
956407324 3:68941398-68941420 GTCACACAAATCAGAGGAACTGG - Intergenic
958990831 3:100842381-100842403 TTCATCCAAGGAAATGGAACAGG + Intronic
961020243 3:123499131-123499153 TTCACCATAGTCAAATGAATAGG - Intronic
961349350 3:126289506-126289528 TTCACAGAAGACAAAGTAACCGG + Intergenic
962148731 3:132870060-132870082 TTCACCTAACTCAAAGCACCAGG + Intergenic
962733532 3:138304372-138304394 TACTCCCAAGTCCAAGGAGCAGG + Intronic
963158508 3:142125737-142125759 TTCTCTCAAGGCAAAGGAACTGG + Intronic
964762287 3:160145872-160145894 TGCACCCAAGACACAGGAGCAGG - Intergenic
965220338 3:165919363-165919385 TTCAACCAAGCAAAAGGAAACGG - Intergenic
966573892 3:181477686-181477708 TCCACCCCAGCCAAAGGAAGTGG - Intergenic
969070901 4:4537960-4537982 TTAAACCAGGTCAAAGGACCTGG + Intronic
970140023 4:12972111-12972133 TTTCCCCAAATCAAAGCAACAGG + Intergenic
972698949 4:41475416-41475438 TTCTCCCCAGTCATATGAACTGG - Intronic
974297214 4:60016399-60016421 TGCAACCAAGTCATAAGAACAGG + Intergenic
976633972 4:87268729-87268751 TTCAACAAAGACAAAGGAAGAGG - Intergenic
977136032 4:93305708-93305730 TTAAACCAAGTCAATGGAACAGG + Intronic
980053538 4:128060548-128060570 TTTACCCAAATTAAAGAAACAGG + Intergenic
980374228 4:131922741-131922763 ATCACCCAAGTCAGACAAACAGG - Intergenic
980676775 4:136094290-136094312 TTCTCCTAAGTCAAAGAGACAGG - Intergenic
988722964 5:33896927-33896949 TTAACCCAAGTAAGAGGAAATGG + Intergenic
990702289 5:58486797-58486819 TTCAACCCAGTCAAAGCAAGGGG - Intergenic
991643829 5:68780629-68780651 ATCACCAAAGTCAAAAGAAGTGG + Intergenic
994228474 5:97283677-97283699 TTCATCCTAGACACAGGAACAGG - Intergenic
995724003 5:115166195-115166217 TTCACTCCAGTCAGTGGAACTGG - Intronic
997689918 5:135821451-135821473 TTCCCCCAAGTCCAGGGAACTGG - Intergenic
1002396136 5:178956578-178956600 TTTTCCCAACTCAAGGGAACTGG - Intronic
1003603541 6:7540767-7540789 TTCACCCAAGTCAGCGGAGGAGG - Intergenic
1004037668 6:11939398-11939420 TTCATACACGTGAAAGGAACTGG - Intergenic
1008156958 6:48027293-48027315 TTTACCAAAGTCACATGAACTGG - Intronic
1008986716 6:57552690-57552712 CTCAACCAAGGCAAAGGAAAAGG - Intronic
1010631721 6:78206816-78206838 TTCTCAAAAGTCAAAGAAACAGG - Intergenic
1012351311 6:98254358-98254380 TCCACCCAAGTTTAAGGAATGGG - Intergenic
1012419243 6:99044675-99044697 TTCTCCCCTCTCAAAGGAACAGG + Intergenic
1013915039 6:115326691-115326713 TTCACACAAGTCAATGGGAAAGG + Intergenic
1015382221 6:132582673-132582695 CTCACCCAAGACACAGGAAATGG + Intergenic
1016836976 6:148487358-148487380 TTCATCTAAGTCAAATCAACAGG - Intronic
1021726348 7:23551195-23551217 TTCACTGAAGTAAAAGGGACAGG + Intergenic
1031973288 7:128078762-128078784 TTCCCCCAAGCCAAAGGAGCAGG + Intronic
1036596857 8:10220967-10220989 TTCAGCCAAGAGCAAGGAACGGG - Intronic
1040962971 8:53054090-53054112 GTCCCTCTAGTCAAAGGAACAGG - Intergenic
1045853714 8:106736393-106736415 TTTAGCCAACTAAAAGGAACTGG - Intronic
1046502791 8:115099732-115099754 TTCTCCCAGGTAAAAGGAAGCGG - Intergenic
1050268484 9:3916466-3916488 TTGACGCCACTCAAAGGAACTGG + Intronic
1052948429 9:34187728-34187750 GACACACAAGTCCAAGGAACCGG - Intronic
1052948435 9:34187851-34187873 GACACACAAGTCCAAGGAACTGG - Intronic
1053159045 9:35800803-35800825 GTCGTCCAAGTCAAAGGCACAGG - Exonic
1053639203 9:40052850-40052872 ATCACCCAAGTCAGACAAACAGG - Intergenic
1053766874 9:41412253-41412275 ATCACCCAAGTCAGACAAACAGG + Intergenic
1054320006 9:63649519-63649541 ATCACCCAAGTCAGACAAACAGG - Intergenic
1054545542 9:66323764-66323786 ATCACCCAAGTCAGACAAACAGG + Intergenic
1057320234 9:94005986-94006008 TTCTCTCTAGCCAAAGGAACAGG - Intergenic
1057320442 9:94007674-94007696 TTCTCTCTAGCCAAAGGAACAGG + Intergenic
1202787078 9_KI270719v1_random:36542-36564 ATCACCCAAGTCAGACAAACAGG - Intergenic
1185504307 X:620085-620107 TCCCCCCAACTCCAAGGAACGGG - Intergenic
1189135137 X:38541302-38541324 TTCACCCAGGTTCAAGGAAAAGG + Intronic
1192184413 X:68936991-68937013 CAGACTCAAGTCAAAGGAACAGG - Intergenic
1193028915 X:76876885-76876907 TGCCCCCAAGTAAAAGGCACAGG + Intergenic
1196890820 X:120289020-120289042 TTCACCCAAGTCAAAGGAACAGG + Intronic
1197012196 X:121579472-121579494 TTCACTCAAGTCTAAATAACAGG - Intergenic
1199097016 X:143755781-143755803 TTCAGTCAAGTCTAAGGACCTGG + Intergenic
1200427613 Y:3038904-3038926 TGCACTAAAGTCAATGGAACTGG + Intergenic