ID: 1196893282

View in Genome Browser
Species Human (GRCh38)
Location X:120310354-120310376
Sequence CTACCAAAAAGCAGCTTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196893279_1196893282 17 Left 1196893279 X:120310314-120310336 CCTAACAGCTGAGGGGGACTGGG 0: 1
1: 0
2: 1
3: 24
4: 181
Right 1196893282 X:120310354-120310376 CTACCAAAAAGCAGCTTCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196893282 Original CRISPR CTACCAAAAAGCAGCTTCGA GGG Intronic
900064449 1:723019-723041 ATACCAAGGAGCAGCTTCTATGG + Intergenic
901615081 1:10532548-10532570 TCACCAGCAAGCAGCTTCGACGG + Intronic
902994872 1:20216581-20216603 CCACCAACAGGCAGCTTCTAGGG - Intergenic
906448793 1:45925970-45925992 CTACCAAAAAGGGGTTTCAAAGG - Intronic
907365410 1:53955145-53955167 CTACCAAAAAGCGGTCTAGATGG + Intronic
909362760 1:74783190-74783212 CTAGCAAAAAGCAGATTCCTCGG + Intergenic
909879086 1:80849690-80849712 AAACAAAAAAGCAGTTTCGAAGG + Intergenic
909924958 1:81428034-81428056 CTAACAAAATGCAGTTTTGAAGG + Intronic
911964894 1:104354536-104354558 CTAGCATAAAGTAGCTTAGATGG - Intergenic
912747062 1:112253721-112253743 CTACCTAAAAGCTGTTTTGAGGG - Intergenic
922030110 1:221789594-221789616 CTACCACAAAGCAGCAGTGAAGG - Intergenic
922575477 1:226658415-226658437 CTGCCAAAAAGGAGCTGGGAGGG + Intronic
923535731 1:234850189-234850211 CTCCAAAAAAGAAGCTTTGATGG - Intergenic
1068803842 10:61172575-61172597 GTTCCAGAAAGCAGCTTGGATGG + Intergenic
1070190575 10:74108340-74108362 CTACCAGAAAGCAGCTACATAGG - Intronic
1071091170 10:81920299-81920321 CAACCAAAAAGAAAATTCGAAGG + Intronic
1071233734 10:83619714-83619736 CTATCCAAAAGCTGCTTGGAGGG - Intergenic
1072044003 10:91636826-91636848 AGACCAAAAAGCAGCTCCGAAGG + Intergenic
1076499154 10:130922344-130922366 CTACAGAAAAGCAGCTAAGAAGG - Intergenic
1080356812 11:31458004-31458026 CTACCCAAAATCAACTTTGATGG - Intronic
1085037070 11:73307266-73307288 ATACACAAAAGGAGCTTCGACGG - Intergenic
1085543854 11:77298766-77298788 CCACAAAAAAACAGCTTTGAGGG + Intronic
1088860820 11:113797756-113797778 AAACCAAAAAGCAGATTAGAGGG - Intergenic
1094228003 12:28067842-28067864 CCACCAAACAGCAGCTGCAAAGG + Intergenic
1094534423 12:31308396-31308418 CTACTAAAAAATAGCTTAGAGGG - Intronic
1102876844 12:116455571-116455593 CTGCCAAAAAGCAGCTTCCCCGG - Intergenic
1103479489 12:121241817-121241839 CTACCAACAGGCAACTGCGAGGG - Intronic
1103740241 12:123086228-123086250 CTACAGAAAAGCAGCTTGCAGGG + Intronic
1106715696 13:32385586-32385608 CTACCAACAAGCAGCCTAGAGGG + Intronic
1110179279 13:72595825-72595847 ATGCCAAAAAGCAGATCCGAAGG + Intergenic
1113694188 13:112332325-112332347 CTCCCAAAAGGCAGCTTCCTGGG + Intergenic
1117907822 14:60608991-60609013 CTACCAAAAAGCTGCCGCCATGG + Intergenic
1119859690 14:77927131-77927153 CTATCACAAAGCAGCTTACAGGG - Intronic
1135992625 16:27227238-27227260 CTCCCAAAAAGCAGCATCCCTGG + Intronic
1148752100 17:49951314-49951336 CTTCCAAAAAGCAGCTTTTTTGG + Intergenic
1156016474 18:32552576-32552598 CTTCTCAAAAGCAGCTGCGAGGG - Intergenic
1161026968 19:2041386-2041408 TTACAAAAAAGCAGCTCTGAGGG + Intronic
1165138360 19:33684907-33684929 CTCCCAACAAGCAGCTTCTCCGG + Exonic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
937330050 2:121021070-121021092 ATACCAAATAACAGCTTCTATGG + Intergenic
940427161 2:153543067-153543089 CTTCCAAATTGCAGCTTCCAAGG - Intergenic
942561113 2:177219821-177219843 TTAACAAAATGCAGTTTCGAAGG + Exonic
944192337 2:197016436-197016458 CTAACAAAATGCAGTTTTGAAGG + Intronic
948173869 2:235928282-235928304 CTCCCCAAACGCACCTTCGATGG + Intronic
1169913579 20:10666799-10666821 CTTCCAAAAAGCAATTCCGAAGG - Intronic
1172916464 20:38447229-38447251 CAACCGAAAAGCAGCTTTGGGGG - Intergenic
1174442222 20:50565182-50565204 ATACCAAAAAGCAGCAAGGAAGG + Intronic
1179580755 21:42342636-42342658 CTATAAAAAAGCATCTTCCAAGG - Intergenic
1184437499 22:44488482-44488504 CTAACAGAAAGCAGACTCGATGG - Intergenic
955245014 3:57217129-57217151 CCACTAAAAAGAAGCTTGGAGGG - Intronic
967711958 3:192719256-192719278 CTAACAAACAGCAGGTTCTAAGG + Intronic
968223152 3:196953428-196953450 CTTCCAAAAGGCAGGTTCCAGGG - Intronic
974305308 4:60129539-60129561 CTACGTAAAAGCGGCTTCTATGG + Intergenic
975944737 4:79692146-79692168 TTAGCAAAAATCAGCTTAGAAGG - Intergenic
983063131 4:163180233-163180255 CTAACAAAGAGCAGCCTAGAAGG + Intergenic
984370201 4:178854508-178854530 CTACCAAAAAGGGCCTTCGAAGG - Intergenic
996389256 5:122942153-122942175 CTAACAGAAAGCAGCTGGGAAGG - Intronic
997122122 5:131185426-131185448 CTACCTAAACGAAGCTTTGAGGG - Intronic
1002560701 5:180080068-180080090 CTGCTAAAAAGCAGGATCGAAGG + Intergenic
1003668224 6:8131418-8131440 ATTCCAAAAAACAGCTTAGATGG - Intergenic
1013048866 6:106512589-106512611 GTACCAAAGGGCAGCTCCGAGGG + Exonic
1015503235 6:133953882-133953904 CTCCCAAAAAGCGGCTTCGTCGG + Intronic
1015708117 6:136110191-136110213 CTTCCAAAAAGCATTTTTGAGGG - Intronic
1016560994 6:145395135-145395157 CTATCAAGCAGCAGCTTGGAGGG + Intergenic
1016782150 6:147971046-147971068 CTATCAAAGATCAGCTTCTAAGG - Intergenic
1020147006 7:5652345-5652367 CTACCAAAAAGCAGGTTAATGGG + Intronic
1025736526 7:64153346-64153368 CAACCTAAAAGCAGCATCTATGG - Intronic
1030734926 7:113036934-113036956 CTATCAAAAAGCAGCTTTTTGGG + Intergenic
1032474960 7:132205290-132205312 CTACTAAAATGCAGATTCCAGGG + Intronic
1038875476 8:31543722-31543744 CTACCAGAAAGCACCTACCATGG - Intergenic
1041251020 8:55934981-55935003 CCACCACAGAGCTGCTTCGATGG - Intronic
1043929081 8:86069692-86069714 TTATCAAAGAGCAGCTGCGAGGG + Exonic
1045326280 8:101119895-101119917 CTATCAAAAAGCATCTTCACTGG + Intergenic
1047805351 8:128353777-128353799 CTACCAAAAAGCAGGCACAAAGG - Intergenic
1053119460 9:35535414-35535436 CTATCAAAAAGAAGCTTAGGCGG - Intronic
1061827749 9:133272358-133272380 CTTCAAAAAATCAGCTTTGACGG - Intronic
1189213080 X:39301131-39301153 CTCTCAGAAAGCAGCTTTGAGGG + Intergenic
1193686837 X:84587071-84587093 CTAACAAAAAGCAGCAGCGGTGG - Intergenic
1195667896 X:107447446-107447468 TTACCACAAAGCAGCTTGAATGG + Intergenic
1196893282 X:120310354-120310376 CTACCAAAAAGCAGCTTCGAGGG + Intronic
1199258237 X:145742178-145742200 CTTCCAAAAAGCATCGTTGAAGG + Intergenic
1200313007 X:155098947-155098969 CAAACAAAAAACAGCTTCAAAGG - Intronic