ID: 1196895416

View in Genome Browser
Species Human (GRCh38)
Location X:120331128-120331150
Sequence ATTGGCTAGGGGTTATGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196895416_1196895424 23 Left 1196895416 X:120331128-120331150 CCAATGCATAACCCCTAGCCAAT No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895416_1196895425 24 Left 1196895416 X:120331128-120331150 CCAATGCATAACCCCTAGCCAAT No data
Right 1196895425 X:120331175-120331197 TTGCTTACCAGCACGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196895416 Original CRISPR ATTGGCTAGGGGTTATGCAT TGG (reversed) Intergenic
No off target data available for this crispr