ID: 1196895424

View in Genome Browser
Species Human (GRCh38)
Location X:120331174-120331196
Sequence GTTGCTTACCAGCACGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196895419_1196895424 12 Left 1196895419 X:120331139-120331161 CCCCTAGCCAATGTACCTGGGAT No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895421_1196895424 10 Left 1196895421 X:120331141-120331163 CCTAGCCAATGTACCTGGGATTT No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895422_1196895424 5 Left 1196895422 X:120331146-120331168 CCAATGTACCTGGGATTTGTTTA No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895415_1196895424 24 Left 1196895415 X:120331127-120331149 CCCAATGCATAACCCCTAGCCAA No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895416_1196895424 23 Left 1196895416 X:120331128-120331150 CCAATGCATAACCCCTAGCCAAT No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895423_1196895424 -3 Left 1196895423 X:120331154-120331176 CCTGGGATTTGTTTAGCACTGTT No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data
1196895420_1196895424 11 Left 1196895420 X:120331140-120331162 CCCTAGCCAATGTACCTGGGATT No data
Right 1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196895424 Original CRISPR GTTGCTTACCAGCACGCCAA AGG Intergenic
No off target data available for this crispr