ID: 1196895520

View in Genome Browser
Species Human (GRCh38)
Location X:120331832-120331854
Sequence CGGGTCTGTAGCAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196895518_1196895520 -5 Left 1196895518 X:120331814-120331836 CCTGTGTGGGAGAAAGGGCGGGT No data
Right 1196895520 X:120331832-120331854 CGGGTCTGTAGCAGAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196895520 Original CRISPR CGGGTCTGTAGCAGAATTGT GGG Intergenic
No off target data available for this crispr