ID: 1196898752

View in Genome Browser
Species Human (GRCh38)
Location X:120362657-120362679
Sequence TACTTTAGAAAGAGAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196898752_1196898757 29 Left 1196898752 X:120362657-120362679 CCAGCTGCTCTCTTTCTAAAGTA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1196898757 X:120362709-120362731 AATCCCCAATAGGAGCAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 104
1196898752_1196898756 26 Left 1196898752 X:120362657-120362679 CCAGCTGCTCTCTTTCTAAAGTA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1196898752_1196898755 25 Left 1196898752 X:120362657-120362679 CCAGCTGCTCTCTTTCTAAAGTA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1196898755 X:120362705-120362727 ATAGAATCCCCAATAGGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 83
1196898752_1196898754 19 Left 1196898752 X:120362657-120362679 CCAGCTGCTCTCTTTCTAAAGTA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1196898754 X:120362699-120362721 AAAATCATAGAATCCCCAATAGG 0: 1
1: 0
2: 1
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196898752 Original CRISPR TACTTTAGAAAGAGAGCAGC TGG (reversed) Intronic
901476312 1:9492153-9492175 AACTTTAAAAAAAGAACAGCTGG - Intergenic
902143298 1:14375225-14375247 CACTTCAGAAAGAGTGCAGGAGG + Intergenic
903450870 1:23452851-23452873 CACTTGGCAAAGAGAGCAGCGGG + Intronic
903601540 1:24545506-24545528 TATTTAAGAAAGATAGCACCAGG - Intergenic
903979157 1:27172780-27172802 TACTTTTTAAAGATAGCATCTGG - Intergenic
904989623 1:34581326-34581348 TACCTTAGAAGCAGAGCAGAAGG + Intergenic
906395062 1:45455795-45455817 CACATTAGAAAGAAAGAAGCTGG + Intronic
906787336 1:48627488-48627510 TACTTGACAAACAGAGCAGCTGG - Intronic
908056126 1:60289250-60289272 TACTTTAAAAAGAGCTCGGCCGG + Intergenic
908562618 1:65321863-65321885 TACTTTAGGAAGAGACAAGCTGG + Intronic
908588445 1:65601193-65601215 CACTTTAGAATGAGAGCACTCGG + Intronic
909023908 1:70461758-70461780 TACTTTATAAAGAAAGGAGGAGG - Intergenic
909275488 1:73680074-73680096 TACTTTAGAAAAAATGCAGCAGG - Intergenic
909394106 1:75150454-75150476 TCCTTTAGAAAGAGATCATAGGG + Intronic
909942209 1:81623929-81623951 CACCTTAGAAAGATATCAGCTGG - Intronic
911079940 1:93918777-93918799 TACTTTATTAAGAGACCACCTGG + Intergenic
912209061 1:107538677-107538699 TGCTTGGGTAAGAGAGCAGCTGG + Intergenic
912400347 1:109386091-109386113 TAATTTATAAAGAAAGCAGCAGG + Intronic
913062219 1:115219029-115219051 TTCTTTTGAAAGAGAATAGCTGG - Intergenic
913179972 1:116311737-116311759 CACTTTAAAAAGAGAGGAGAAGG - Intergenic
915016489 1:152738743-152738765 TACTTTGGGTAGAGAGCAGCAGG + Intronic
915459543 1:156061564-156061586 TCCTTCAGAAAGAAAGCTGCAGG + Intronic
915897549 1:159823585-159823607 TCCTTAATTAAGAGAGCAGCTGG - Intergenic
918031291 1:180814771-180814793 TACTTTTAAATGAGAGCATCAGG + Intronic
918175036 1:182036104-182036126 TCATCTAGAAAGAGAGAAGCAGG + Intergenic
918599820 1:186343367-186343389 ACTTTTAGAAAGAGAGCTGCAGG - Exonic
919518838 1:198561847-198561869 TACTTTAGAAAGAGAAGGCCGGG + Intergenic
920047147 1:203140669-203140691 TAAGGTGGAAAGAGAGCAGCTGG - Intronic
920279829 1:204834466-204834488 TCCTGGAGGAAGAGAGCAGCAGG - Intronic
920624047 1:207578463-207578485 TACTTGAGAGAGATTGCAGCTGG - Intronic
921764567 1:218955372-218955394 TCCTTTCGAAAGAAAACAGCAGG - Intergenic
921976932 1:221213145-221213167 AATTTTAGAAAGAGAGCCACAGG - Intergenic
922094024 1:222425818-222425840 TACTTTAGAATCAGAGGACCTGG - Intergenic
923412763 1:233726129-233726151 TCCTCTAGAAAGAGTGCAGCAGG + Intergenic
924391265 1:243561735-243561757 AGCTTTCCAAAGAGAGCAGCTGG - Intronic
924817303 1:247453960-247453982 TGCTTTAAAAAAAGAGCAGCTGG + Intergenic
1062826554 10:573368-573390 TAGTTTACACAGAGCGCAGCCGG + Intronic
1063264831 10:4436119-4436141 TAATTTTGAAAGAAAGCAGTTGG + Intergenic
1063813568 10:9743818-9743840 TTCCTGACAAAGAGAGCAGCTGG - Intergenic
1064423246 10:15208336-15208358 TACTGTAGACAGATAGCAGAGGG + Intergenic
1065319622 10:24497266-24497288 TACTGTGGAAAGAGAACAGATGG + Intronic
1065475477 10:26132882-26132904 AACTTTAGAATGTGAGCAGCTGG - Intronic
1065644954 10:27824418-27824440 TACATGAGACAGAGAGCAGATGG - Intronic
1075283152 10:121158589-121158611 TAGTTTATAAAGAAAACAGCTGG - Intergenic
1076362102 10:129896693-129896715 TGCTTAAGGAGGAGAGCAGCGGG - Intronic
1079059603 11:17236726-17236748 TAATTTAGAGAAAGCGCAGCCGG + Intronic
1085264740 11:75230574-75230596 TACTTCCGAAAGAAAGCATCTGG - Intergenic
1085791012 11:79497892-79497914 GACTTTAGAGAAAGAGCAGAGGG + Intergenic
1086603191 11:88660939-88660961 TATTTTAGAAGCAGAGCAGAAGG - Intronic
1087301381 11:96440034-96440056 GACTTTAGAATCAGAGCACCTGG + Intronic
1087660422 11:100981524-100981546 TATTTTGGAAAGAGACCAGTTGG + Intronic
1088225700 11:107617286-107617308 TACATTCGAAAAAGAGCTGCGGG - Intronic
1090094782 11:123731790-123731812 TAATTTAGAAAGATAATAGCTGG - Intronic
1091364036 11:135002211-135002233 TCATTAAGACAGAGAGCAGCAGG - Intergenic
1093198628 12:16159890-16159912 GAATGCAGAAAGAGAGCAGCTGG + Intergenic
1093369625 12:18352225-18352247 GACTTTAGAAAGACAACATCTGG - Intronic
1093409590 12:18848471-18848493 TAATTTGGAAAGAGGCCAGCAGG + Intergenic
1094106648 12:26819489-26819511 TACTTTAGAAAGATAGAATAGGG - Intronic
1094678201 12:32642794-32642816 TTCTTTAATAAGAGAGAAGCGGG - Exonic
1094779170 12:33770700-33770722 TACTTTAGCAAGAGAGAAAAAGG + Intergenic
1099044647 12:77701092-77701114 TCTTTTAGAAACAGAGAAGCAGG - Intergenic
1099532167 12:83796880-83796902 TAAGCTAGAAAGAGAGCTGCAGG - Intergenic
1099583715 12:84487903-84487925 TACTTTAAAAAGGTAGCAGCAGG + Intergenic
1102274503 12:111570383-111570405 GTATTTAGAAAGAGAACAGCTGG - Intronic
1103089802 12:118089797-118089819 TATTTTGGAAGGAGACCAGCAGG - Intronic
1103664079 12:122548103-122548125 TACTTTAAAAAGAGTTCTGCAGG - Intronic
1104692545 12:130838360-130838382 TACTTTAGCAAGGGAAAAGCAGG - Intronic
1105705157 13:22963766-22963788 TATTTTCAACAGAGAGCAGCTGG - Intergenic
1105858072 13:24388782-24388804 TATTTTCTACAGAGAGCAGCTGG - Intergenic
1106461933 13:29978553-29978575 AACTTTATAAAGAGAGTATCAGG - Intergenic
1110578445 13:77088952-77088974 TCCTTTAGAAAGAGAGCTGTGGG + Exonic
1110726967 13:78837206-78837228 TACATTAGTAAGGAAGCAGCTGG + Intergenic
1111925019 13:94454107-94454129 TAATTTAGAAAATGTGCAGCAGG - Intronic
1112261687 13:97883350-97883372 TAATTTAAAACCAGAGCAGCAGG - Intergenic
1112446480 13:99469175-99469197 TTCTTTAGAAAGACAGCCCCTGG - Intergenic
1112869902 13:103957746-103957768 TACTATTGAAAGAGTTCAGCAGG + Intergenic
1114254784 14:20992246-20992268 GACTTTAGAAAGAGAGTTGGGGG + Intronic
1116528711 14:45939083-45939105 TAAATTAGAATGAGAGCAGATGG - Intergenic
1117456556 14:55903500-55903522 TACTTTAAAAAAACAGCAGTAGG + Intergenic
1119634948 14:76266486-76266508 TGATTTAGAAAGAGAGGAGAGGG + Intergenic
1122190410 14:100038122-100038144 TACTGTAGACGGAGAGCTGCAGG + Intronic
1122617931 14:103033516-103033538 ACCTTTAGAAGTAGAGCAGCTGG - Intronic
1125425884 15:39549048-39549070 TACCTTATAAAGTCAGCAGCTGG - Intergenic
1126338025 15:47607806-47607828 TTCTTTAAAGAGAGAGAAGCTGG + Intronic
1130374262 15:83314075-83314097 TACTGTAGGAATAGAGCAGAAGG + Intergenic
1130665365 15:85864801-85864823 TACCTTAGAAGGAGAGCGGGAGG - Intergenic
1130973812 15:88757399-88757421 ATCTTTAGAAAGAGATCACCTGG + Intergenic
1131743368 15:95418523-95418545 TACTATAGAAAGAGAACCCCTGG - Intergenic
1132565987 16:623189-623211 AACTCTAGAAAGAGAGCAGAAGG - Intronic
1136111939 16:28068953-28068975 TTCATTAGAAAGTGATCAGCTGG + Intergenic
1136135211 16:28252293-28252315 TAATTTAGAAAGAGAAGAGTTGG - Intergenic
1137573823 16:49585094-49585116 TAATTTAGAAAGAGGGTGGCTGG - Intronic
1138086893 16:54141688-54141710 TATCTTAGAAAGAGGGGAGCAGG + Intergenic
1141125981 16:81401437-81401459 GACTTTAGAAAGAAAGAGGCAGG + Intergenic
1141183694 16:81772200-81772222 TATTTGAGACAGAGAGCAGAGGG + Intronic
1142420146 16:89964881-89964903 TAGTAGAGAAAGGGAGCAGCTGG - Intronic
1144282406 17:13739338-13739360 GACATTACAAAGAAAGCAGCTGG + Intergenic
1146693777 17:34893764-34893786 TAATTAAGAAAAAGAGCAGTAGG - Intergenic
1146961453 17:36983659-36983681 TTCTTAAGACAGAGAGCAACTGG + Intronic
1147637294 17:41971936-41971958 TACTTTGGAAAGAGACCCCCAGG + Exonic
1151749688 17:76029465-76029487 GACTCCAGACAGAGAGCAGCCGG + Intergenic
1152078588 17:78172975-78172997 CACTCTAGGAAGGGAGCAGCAGG - Exonic
1154193037 18:12246094-12246116 TACTTTCCAAAGAGTGGAGCAGG + Intergenic
1156742081 18:40343272-40343294 TCCTGCACAAAGAGAGCAGCAGG - Intergenic
1158326715 18:56320853-56320875 TAAGTTAGAAAAAGATCAGCAGG - Intergenic
1159216736 18:65401800-65401822 TACTTTAGCCAGAGAACTGCTGG + Intergenic
1160534052 18:79581727-79581749 TTCTCTCCAAAGAGAGCAGCAGG + Intergenic
1164512320 19:28907664-28907686 TACTTTAAACAAAGAGCCGCTGG + Intergenic
1167797961 19:51722743-51722765 TACTTTCAAAAGAGACCAGATGG + Intronic
926554836 2:14344758-14344780 TTCTGAAGAAAGAGAGCAGTAGG - Intergenic
926756510 2:16240659-16240681 TCCTTGAGATAGAGAGGAGCTGG - Intergenic
926984432 2:18606717-18606739 GACTATAGAAAGAGAGAAGTTGG - Intergenic
928284793 2:29980372-29980394 TGCTTTATAAAGGGAGCAGGGGG - Intergenic
929877511 2:45808939-45808961 TAATTTAGGAAGAGGGCAACAGG - Intronic
929995658 2:46824925-46824947 TAGTTAAGCAAGAGAGGAGCAGG - Intronic
930649791 2:53953017-53953039 TACTATAAAAAGAGACCAACAGG + Intronic
931715253 2:65023735-65023757 CATGTTAGAAAGAGAACAGCAGG - Exonic
931842478 2:66168924-66168946 TATTTCAGAAAGAGATCACCAGG + Intergenic
932234744 2:70111995-70112017 TACTATTGGATGAGAGCAGCAGG + Intergenic
933459093 2:82556212-82556234 CAATTTAGAAAGAAATCAGCCGG - Intergenic
933826958 2:86170684-86170706 TAGTTTAAGAAGAGAGCAACTGG + Intronic
934146543 2:89100277-89100299 TACCTGGGAAACAGAGCAGCAGG + Intergenic
934222725 2:90100298-90100320 TACCTGGGAAACAGAGCAGCAGG - Intergenic
935169098 2:100596463-100596485 TACTTAAGAAAGATAACTGCCGG - Intergenic
935205279 2:100891435-100891457 GACTTTAGAACGAGAACAGGTGG - Intronic
935323479 2:101911468-101911490 TACTCTAGAAAGAAACCTGCAGG + Intergenic
936882071 2:117265686-117265708 TACTTTAAATAGAGTGCAGTTGG - Intergenic
937017564 2:118619625-118619647 AACTTTAGAGACAGAGCTGCTGG - Intergenic
937612369 2:123877637-123877659 TACTTTAGAAAAAGAGGCACAGG - Intergenic
938691223 2:133791392-133791414 TACTTGAAAACCAGAGCAGCTGG + Intergenic
939759242 2:146153888-146153910 TACTTTAGAAAGAGACCCTAAGG + Intergenic
940731321 2:157396113-157396135 TACTGGAGAAAGAGAGCAATAGG + Intergenic
941274308 2:163471435-163471457 TGCTGAAGAAAGAGAGCAGAGGG - Intergenic
941422185 2:165296175-165296197 TACTTTAGACAGAGGGAAGGAGG - Intronic
941540841 2:166782294-166782316 TACTTTAGAAGCTGAGCAGTTGG - Intergenic
943994739 2:194747605-194747627 TCCTTGAGTTAGAGAGCAGCAGG + Intergenic
946665329 2:222043864-222043886 TACTTTAGAAGCAGAGGAGATGG + Intergenic
947701118 2:232234879-232234901 CTCTTCAGAAAGAGAGCAGGTGG + Intronic
1169070374 20:2724422-2724444 TACTTTAGAAAGAAAGAAAATGG - Intronic
1170018516 20:11810025-11810047 AACATTAGTAGGAGAGCAGCAGG + Intergenic
1171312804 20:24159258-24159280 TGCTTTTGAAAGAGTGCACCAGG - Intergenic
1173513263 20:43647014-43647036 TAGTTTACAAAGAGAGAATCAGG - Exonic
1177818951 21:26010511-26010533 TACATTAAAATGAGACCAGCCGG + Intronic
1178619584 21:34161933-34161955 TCATCTAGAAAGAGAGGAGCAGG + Intergenic
1178884361 21:36473712-36473734 AACGTTAGATAGAGAGGAGCAGG + Intronic
1182091331 22:27596899-27596921 TTCTTGAGCAAGAGAGGAGCAGG - Intergenic
1182389383 22:29979064-29979086 TACCTTAGAGGGAGAACAGCTGG - Intronic
1183879629 22:40816502-40816524 AACTTTTTAAAGAGAGCAGATGG - Intronic
950457110 3:13099427-13099449 TACTTTCGAAAGAGTGAAGGTGG + Intergenic
952073007 3:29661827-29661849 TACTATGGAAATACAGCAGCAGG - Intronic
952202011 3:31139335-31139357 AAATTTAGAAAGAGAACACCAGG + Intergenic
953441671 3:42924047-42924069 TCATTTAGAAAGAGGGAAGCAGG + Intronic
953454494 3:43030846-43030868 TACTTTTGAGAGAAAGCAGGGGG + Intronic
958103214 3:89040346-89040368 TCCTTTAAAAAGAAAGCAGTTGG - Intergenic
959034932 3:101350070-101350092 TATTTTAGACAGAAAGCAGTAGG - Intronic
959216824 3:103461191-103461213 TACTATATAGAGAGAGCAACAGG - Intergenic
960156478 3:114301718-114301740 CACTGTAGAAAGGGAGCAACAGG - Intronic
960692545 3:120361981-120362003 TATTATAGAAAGAGAGCTCCTGG + Intergenic
960878868 3:122324829-122324851 GACTTTAGAAAGAAAGCAAAAGG - Intergenic
961172965 3:124812013-124812035 GACTTTGGAAAGAGATCATCAGG + Intronic
962392974 3:134988835-134988857 TAATTTAGAAATAGAGAAACTGG + Intronic
963036889 3:141038234-141038256 TTCTTTACAAAGAGGGAAGCAGG - Intergenic
964814317 3:160700753-160700775 TCCTTTAGGAAGTGAGGAGCTGG + Intergenic
971401991 4:26284762-26284784 GACTTTAAAAAGAGTTCAGCCGG - Intronic
971980851 4:33747901-33747923 GACCTTTGAAAGGGAGCAGCAGG + Intergenic
976188968 4:82470915-82470937 TACTCCAGATAGAGACCAGCTGG - Intergenic
977280829 4:95037775-95037797 TACTTTAGAAAGAGAGAGATAGG + Intronic
979856854 4:125644291-125644313 AACTTTAGACAAAGAGAAGCTGG + Intergenic
980594992 4:134942718-134942740 TACTTGAGAAACAGAGCAATGGG + Intergenic
980784028 4:137529718-137529740 TACCTTAGAAAGAGGGCAGATGG - Exonic
983256881 4:165409871-165409893 TACCTTAGAAAGAGGACAACTGG - Intronic
983490806 4:168386895-168386917 TATTTTAGATAGAGAGCAAAAGG + Intronic
984665500 4:182423259-182423281 GACTTTAGGAAGAGAGGTGCTGG + Intronic
985216897 4:187663137-187663159 TACTTTAGAAAGAAAGCCTTGGG - Intergenic
990001471 5:50898211-50898233 TACTTTAGGAAAAGATCATCTGG - Intergenic
990819964 5:59827626-59827648 TAATTTAGAAAGAGAAGACCAGG + Intronic
990873112 5:60455376-60455398 TACCTTAGAGAGAGAGAAGAAGG + Intronic
997894088 5:137700358-137700380 GACTTAAAAAATAGAGCAGCCGG + Intronic
998260912 5:140631398-140631420 TACCTTTGAAAGGGAGCAGCTGG + Intergenic
998826345 5:146105178-146105200 TACATTAGAAAGACATCAGGAGG + Intergenic
999331500 5:150676686-150676708 TCCTGGAGAAAGAGAGCAGCAGG - Exonic
999529018 5:152441162-152441184 TGCTTTTAAAAGAGAGAAGCTGG - Intergenic
999884951 5:155911908-155911930 TCCTTTAGAGAGAGGGCTGCAGG - Intronic
1000198870 5:158987998-158988020 TGCTTCAGAAACAGAGGAGCTGG - Intronic
1001012403 5:168110203-168110225 GTCTTTAGAAAGAGGTCAGCTGG + Intronic
1003009137 6:2409930-2409952 TACTTTAAATAAAGAGCAGCCGG - Intergenic
1003216877 6:4122087-4122109 ATTTTCAGAAAGAGAGCAGCAGG + Intronic
1003488303 6:6598627-6598649 CACTTGAGAAAAAAAGCAGCAGG - Intronic
1004953997 6:20706720-20706742 CACATCATAAAGAGAGCAGCAGG - Intronic
1007441141 6:41861504-41861526 TACTGGAGACAGAAAGCAGCGGG - Intronic
1009424045 6:63494717-63494739 TTCTTTAGAAACAGAACAGCTGG - Intergenic
1009824774 6:68854142-68854164 TGCTTTAGAAAGAGAGTGGATGG - Intronic
1010460149 6:76105223-76105245 TACTTTAAAACAAGAGAAGCAGG - Intergenic
1010541655 6:77099302-77099324 TCATCTAGAAAGAGAGGAGCAGG - Intergenic
1010971750 6:82270186-82270208 TACTTTGGAAACAGAGCAGCCGG + Intergenic
1012627887 6:101426687-101426709 TAGATTAGAAAGAGAGAGGCAGG - Intronic
1014083038 6:117310153-117310175 TACTATAGAAAGAGAGGGGAAGG - Exonic
1014795053 6:125715050-125715072 TCCTTTAGACAGAGGTCAGCAGG - Intergenic
1014820253 6:125981351-125981373 TATGTTAGAAAGGGAGCATCTGG - Intergenic
1015209685 6:130683097-130683119 TTCTCTAGAAAGAGAGCATAGGG + Intergenic
1019809495 7:3154482-3154504 TGCTTCAGAGACAGAGCAGCAGG - Intronic
1020468443 7:8507691-8507713 TACATTAGAAAGATAACAGCAGG + Intronic
1020982906 7:15094465-15094487 TACTTTGAAAAGCAAGCAGCGGG + Intergenic
1024447786 7:49501633-49501655 TCCTTTAGAAAGAGTGCATTTGG + Intergenic
1025757965 7:64363074-64363096 TCATCTAGAAAGAGAGGAGCAGG + Intergenic
1025970650 7:66321177-66321199 CACATTGGAAAGTGAGCAGCTGG - Intronic
1027132679 7:75602460-75602482 GAATTTAGAAAAACAGCAGCTGG - Intronic
1027357711 7:77375462-77375484 GTCTTTAGAAGGAGAGCAGAGGG + Intronic
1027454996 7:78378882-78378904 TAATTTAAAAAGAGAGGAGAGGG + Intronic
1030209842 7:106985524-106985546 TACTTGAGATAGGGAGCAGCTGG + Intergenic
1030623867 7:111822047-111822069 TCCTTTATACAGAGACCAGCAGG - Intronic
1031130820 7:117831562-117831584 TACTTTAGAAAGAGCACAGATGG - Intronic
1033847014 7:145445642-145445664 TATTTTAGAAAAACACCAGCAGG - Intergenic
1034128629 7:148696798-148696820 TAAAGTAGAAAGAGAGCAGCAGG + Intergenic
1034129759 7:148704195-148704217 TAATTTATAAAAAGAGGAGCAGG + Intronic
1036605845 8:10304816-10304838 ACATTTTGAAAGAGAGCAGCAGG + Intronic
1041526303 8:58810298-58810320 TACACTAAAAAGATAGCAGCTGG - Intronic
1041545445 8:59037335-59037357 ACCTTAAGAAAGAGAGAAGCAGG - Intronic
1041980128 8:63847925-63847947 TACTTTAGAAAGAGAAAAGTGGG - Intergenic
1043553192 8:81398798-81398820 TGATTTAGAAAGAGAGGAACTGG + Intergenic
1044217411 8:89628508-89628530 GTCTTGAGAAAGAAAGCAGCTGG + Intergenic
1045544018 8:103112107-103112129 TTCTTTAGAATGAGAGCTGTTGG + Intergenic
1045557539 8:103229082-103229104 CACTTTAGAAAGCCAGCACCTGG + Exonic
1046715497 8:117562265-117562287 TACTTGAGAAAGGGAGCAGGTGG - Intergenic
1049030302 8:140031513-140031535 TATTATAGAAACAGAGCAGAAGG - Intronic
1050777575 9:9285585-9285607 TGCTTTAGAAAGAGATGAGGTGG - Intronic
1050839354 9:10127789-10127811 TATGTTAGAAAGAGAGGAACTGG - Intronic
1051632696 9:19155008-19155030 TACAGTAGAAAGAGAGCAGTAGG - Intergenic
1054202712 9:62101019-62101041 TTCAGAAGAAAGAGAGCAGCAGG - Intergenic
1054635651 9:67487346-67487368 TTCAGAAGAAAGAGAGCAGCAGG + Intergenic
1055361173 9:75491965-75491987 TACCCTAGAAAGGGAGAAGCAGG - Intergenic
1057308683 9:93927739-93927761 TGGTTTAGAGTGAGAGCAGCAGG + Intergenic
1057893736 9:98889651-98889673 TATTTTATAGAGACAGCAGCAGG + Intergenic
1059286465 9:113176737-113176759 TAATTTAAAAAAAGAGCTGCTGG - Intronic
1060581914 9:124756281-124756303 TAGTTGAGAGAAAGAGCAGCTGG + Intronic
1060731019 9:126037130-126037152 TCCTTGAGAAAGTGACCAGCAGG + Intergenic
1061824567 9:133249694-133249716 TTATTTAGAAAGGGAGCAGGAGG + Intergenic
1062066569 9:134530853-134530875 TACCATAGAAAGAGAGAAGGGGG + Intergenic
1185684785 X:1919350-1919372 AACTTAAGAAAGAGAGAGGCAGG + Intergenic
1186135874 X:6520009-6520031 TATTTCAGATAGAGTGCAGCAGG - Intergenic
1189577543 X:42370571-42370593 TTCTTGAGAAAGAGGGCATCTGG + Intergenic
1190168254 X:48091139-48091161 TGCATCAGAAAGAGATCAGCAGG - Intergenic
1190168988 X:48096539-48096561 TGCATCAGAAAGAGATCAGCAGG + Intergenic
1192087276 X:68113264-68113286 TGCTTTGGGAAGAAAGCAGCTGG + Intronic
1195397058 X:104422667-104422689 TACTTTAGAAATAAAGAAACAGG + Intergenic
1196898752 X:120362657-120362679 TACTTTAGAAAGAGAGCAGCTGG - Intronic
1197314275 X:124945268-124945290 TGGTTGAGAAAGAGAGTAGCAGG + Intronic
1198076076 X:133194439-133194461 TGCTATAGAAAGAGAGAAGAGGG - Intergenic
1199043446 X:143140892-143140914 TCATCTAGAAAGAGAGGAGCAGG + Intergenic
1199792330 X:151167083-151167105 TGCTATTGAAAAAGAGCAGCTGG + Intergenic