ID: 1196898753

View in Genome Browser
Species Human (GRCh38)
Location X:120362686-120362708
Sequence CTATGATTTTAGCTATAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196898753_1196898757 0 Left 1196898753 X:120362686-120362708 CCAAACTATAGCTAAAATCATAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1196898757 X:120362709-120362731 AATCCCCAATAGGAGCAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 104
1196898753_1196898754 -10 Left 1196898753 X:120362686-120362708 CCAAACTATAGCTAAAATCATAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1196898754 X:120362699-120362721 AAAATCATAGAATCCCCAATAGG 0: 1
1: 0
2: 1
3: 13
4: 159
1196898753_1196898756 -3 Left 1196898753 X:120362686-120362708 CCAAACTATAGCTAAAATCATAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1196898753_1196898755 -4 Left 1196898753 X:120362686-120362708 CCAAACTATAGCTAAAATCATAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1196898755 X:120362705-120362727 ATAGAATCCCCAATAGGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196898753 Original CRISPR CTATGATTTTAGCTATAGTT TGG (reversed) Intronic
903506655 1:23840612-23840634 CTATGATGTTGGCTGTTGTTTGG + Intergenic
904148158 1:28412560-28412582 CAATGATTTCTGCTACAGTTTGG + Intronic
906084815 1:43122453-43122475 CTATGTTTTTTCCTATAGATAGG + Intergenic
908350671 1:63284279-63284301 CTATTTTTTAAGCTATAGGTTGG + Intergenic
908394757 1:63715455-63715477 ATATGGTTTAAGCCATAGTTTGG - Intergenic
908545140 1:65154824-65154846 CTATGATTTAAGTTCTATTTTGG - Intronic
909995254 1:82271002-82271024 CTATCATTTTATCTAGTGTTTGG - Intergenic
910133775 1:83941649-83941671 TTGTAATTTTAACTATAGTTAGG + Intronic
910196211 1:84642262-84642284 CTGTGACTGTAGCTACAGTTGGG + Intergenic
910956027 1:92706124-92706146 TTATGTTTTTAGCAATATTTGGG - Intronic
914416741 1:147491102-147491124 TTAGAATTTAAGCTATAGTTCGG + Intergenic
914893177 1:151646349-151646371 GTATAATTATTGCTATAGTTAGG + Intronic
919268754 1:195310618-195310640 CTGGGATTTTGGATATAGTTGGG + Intergenic
919515898 1:198522270-198522292 CTCTGATTATATGTATAGTTTGG - Intergenic
921170576 1:212544449-212544471 TTATGAGTTTATCTATAGTTAGG + Intergenic
921959206 1:221016678-221016700 CTATAATTTTATCTTTATTTGGG + Intergenic
922120920 1:222666933-222666955 TTATGATTTTAGTTTTAGTGTGG - Exonic
923368051 1:233282898-233282920 CTATCATTTGATATATAGTTAGG - Intronic
924601686 1:245495601-245495623 CTATAATTTGGTCTATAGTTTGG + Intronic
924675860 1:246177078-246177100 CTATGATTTTATTTATGGCTTGG + Intronic
1064279580 10:13939273-13939295 ACATGATTTTAGTTATATTTTGG + Intronic
1064732008 10:18341051-18341073 GTATGATTTTAGCTCAAGCTCGG - Intronic
1065899608 10:30193857-30193879 CAATGATTTTAGCTAGATCTGGG - Intergenic
1066121435 10:32291312-32291334 GTATAATTTTAGGTATAATTTGG - Exonic
1066207113 10:33200204-33200226 TTATCAGTTTTGCTATAGTTTGG + Intronic
1067185860 10:44027269-44027291 CTATGTTTTTAGTTACATTTAGG - Intergenic
1068781606 10:60924874-60924896 ATATGCTCTTAGATATAGTTTGG + Intronic
1073635225 10:105191203-105191225 CTATGATTTTTGATACATTTTGG + Intronic
1074705903 10:116131665-116131687 GTATGATTATATATATAGTTCGG + Intronic
1075359367 10:121816082-121816104 CTAACATATTAGCTATAGTAGGG - Intronic
1075986555 10:126791166-126791188 TTATGATTATTGCTATATTTGGG - Intergenic
1078040642 11:7859492-7859514 CCAGGATTTTAGCAATTGTTAGG - Intergenic
1079072733 11:17362089-17362111 ATATGATATTAGCTATTTTTTGG + Intronic
1079762673 11:24350574-24350596 CTAAGATTTTGGTTAGAGTTTGG + Intergenic
1079977505 11:27110158-27110180 CTATGCATGTAGCCATAGTTAGG + Intronic
1087827678 11:102784873-102784895 CTATTATTTTAAATATATTTGGG - Intergenic
1089029686 11:115312465-115312487 CTGTGATTTCAGCTATATTGAGG - Intronic
1090999746 11:131899786-131899808 ATTTTATTTTAGCTAGAGTTTGG + Intronic
1094464382 12:30736414-30736436 CTAAGATTTTTCCTATAGATGGG + Intronic
1095445164 12:42275512-42275534 CTATGAATGTCGCTATAGTTTGG + Intronic
1098478119 12:70928940-70928962 ATATGATTTTAGTTTAAGTTTGG - Intergenic
1099565474 12:84239096-84239118 CTATGATTGTTGTTATTGTTGGG + Intergenic
1099631955 12:85161452-85161474 TTATAATTTAACCTATAGTTTGG + Intronic
1101409109 12:104454718-104454740 CAATGATTCTAACTGTAGTTGGG + Intergenic
1103150424 12:118633568-118633590 CTGTGATTTTTGCTATACCTTGG - Intergenic
1106816720 13:33416765-33416787 CTATGATCTTGGGTTTAGTTAGG + Intergenic
1107422718 13:40263989-40264011 CTATGAATATAGTTGTAGTTTGG - Intergenic
1107433628 13:40362438-40362460 CAAGAATTTGAGCTATAGTTAGG + Intergenic
1108138318 13:47389956-47389978 CTATATTTTTTGCAATAGTTTGG - Intergenic
1109144504 13:58761331-58761353 CAATGATTTTAGCAATAATTTGG - Intergenic
1110019500 13:70452870-70452892 ATATGATTTATGATATAGTTTGG + Intergenic
1110655253 13:77990506-77990528 CTGTGATTTATGCTATAGTTTGG + Intergenic
1112229573 13:97574925-97574947 GTATGATTTTCTCTATATTTAGG + Intergenic
1114712025 14:24788351-24788373 CTATCATTATAGCTGTGGTTTGG + Intergenic
1115361336 14:32506646-32506668 CTATGACTTTTGTCATAGTTGGG + Intronic
1116013385 14:39377634-39377656 CTATGATTTTAAGTAAAATTGGG - Intronic
1117426369 14:55602372-55602394 TTAGGATTTTTGCTCTAGTTAGG + Intronic
1117777628 14:59198825-59198847 CTTTGATTTTAGGTTCAGTTTGG + Intronic
1118244175 14:64092528-64092550 CTATAATTTTAGCCATAGGCTGG - Intronic
1118527065 14:66657383-66657405 CAATGATTTTAGCTAGATTATGG - Intronic
1119270082 14:73295880-73295902 CTATGATTTGAGATATTATTTGG + Intronic
1119992742 14:79217508-79217530 CTATGATATTTGATATGGTTTGG - Intronic
1120070745 14:80099586-80099608 CTTTGCCTTTAGCTTTAGTTTGG - Intergenic
1121665387 14:95667956-95667978 TCATGATTTTGTCTATAGTTTGG + Intergenic
1125150533 15:36526156-36526178 ATATCATTTTAACTATAGCTAGG + Intergenic
1125376181 15:39032062-39032084 GTGTGATTTTAGCTATATTGTGG + Intergenic
1126028383 15:44471818-44471840 CTATGGATTTTGCTATATTTTGG + Intronic
1126479955 15:49107939-49107961 CTATGATTTTAAGTAAAATTGGG - Intronic
1126506642 15:49412579-49412601 CTTTGATTTCAGCTATAAATGGG - Intronic
1127409076 15:58686742-58686764 CTGTGATTTTGGCTATAGGACGG - Intronic
1128468759 15:67934468-67934490 GTATGATCTTTGATATAGTTTGG - Intergenic
1129259964 15:74360000-74360022 ATGTGACTTTAGCAATAGTTGGG + Intronic
1129874934 15:78968445-78968467 TTATGATTTTTGCTAGAGATAGG + Intronic
1131998437 15:98156017-98156039 CTATGAGTTCAGCTTCAGTTTGG - Intergenic
1134304425 16:13019520-13019542 CTCTGATTTTAGCTATTTTTAGG + Intronic
1136017723 16:27415150-27415172 CTATGGTGTTGGCTATTGTTTGG - Intronic
1147597263 17:41725132-41725154 GTATGATTTTCGCTACAGTGAGG - Exonic
1149902169 17:60490614-60490636 CTATGATTGTTGATATGGTTTGG + Intronic
1150361354 17:64537444-64537466 CTATGATTTTAACTTTAGTTAGG + Intronic
1151123306 17:71817420-71817442 ATTTGATCTTTGCTATAGTTTGG + Intergenic
1153367679 18:4276252-4276274 CTTTGACTTTGGCTATAGTGTGG + Intronic
1153657582 18:7297834-7297856 ATGTGAATTTTGCTATAGTTGGG + Intergenic
1155323760 18:24645500-24645522 TTATCATTTTAGCAATTGTTTGG + Intergenic
1156997878 18:43489744-43489766 CTAAGATTTTAACTCTAGTCTGG + Intergenic
1159071893 18:63633142-63633164 ATATGATTTTAGCTGTGGGTTGG - Intergenic
927542093 2:23921468-23921490 TTATGAGTTTACCTATAATTAGG + Intronic
928895979 2:36264000-36264022 CCATGATTTTAGATATACATTGG - Intergenic
929316792 2:40488992-40489014 GTATGATTGTTGCTATAGTTAGG - Intronic
930426239 2:51216503-51216525 CTGTAATTTTAGTTTTAGTTAGG + Intergenic
930466201 2:51753165-51753187 CTGTGATTTCAGCCACAGTTGGG + Intergenic
930539243 2:52683736-52683758 TTCTGATGTTAGCTATGGTTTGG - Intergenic
934866488 2:97818152-97818174 CTATTATTTTAGCTTAAGTAGGG + Intronic
936819201 2:116498216-116498238 CTCTGATTTTACCTAATGTTAGG + Intergenic
937803911 2:126115541-126115563 TTATGATTTTAGCTATTTTAGGG + Intergenic
938366967 2:130742546-130742568 CTAGGATTATAGCTCTTGTTTGG + Intergenic
938603591 2:132868724-132868746 CTATTATTTTACCGAAAGTTTGG + Intronic
941316624 2:164001362-164001384 TTAATATTTTAGCTATATTTGGG + Intergenic
941722035 2:168822675-168822697 CCCTCATTTTAGCTATAGATGGG + Intronic
943890214 2:193277047-193277069 CTTCCATTTTAGCTTTAGTTTGG + Intergenic
944344213 2:198640976-198640998 CAATGAATTTAGGTTTAGTTGGG - Intergenic
945104203 2:206293722-206293744 CTTTAATTTTAGCTATTGTAAGG - Intronic
945167127 2:206957997-206958019 TTATGCCTTTATCTATAGTTAGG + Intronic
947581967 2:231325907-231325929 CTGCGATTTAAGCTCTAGTTGGG - Intronic
948774101 2:240272484-240272506 CTGTGATTTGACCTATATTTTGG - Intergenic
1169559179 20:6780958-6780980 CTATGAGCTTAGTTACAGTTCGG + Intergenic
1174916534 20:54659870-54659892 CTATCATTTTAGGTATAGAGTGG - Intergenic
1177681514 21:24377455-24377477 GTATGATTTTGGCTATATTAAGG - Intergenic
1177733201 21:25055741-25055763 ATATGATTTTATCTATGTTTTGG - Intergenic
1178880430 21:36445944-36445966 ATATGATGTTAGCTGTAGTCAGG - Intergenic
1182648768 22:31833330-31833352 CAATGATTTTACCTATAACTGGG - Intronic
949491709 3:4595537-4595559 CTAAGAGTTTTGATATAGTTTGG - Intronic
950728770 3:14937683-14937705 CTATGCTTTTTCCTATATTTTGG + Intergenic
952233305 3:31454171-31454193 CTATGACTTTAGACATATTTTGG - Intergenic
956482395 3:69686335-69686357 CTATGGGTTTACCTATAGTCTGG - Intergenic
957395431 3:79630514-79630536 CAATGATGTTGGCTATAGATTGG - Intronic
958628451 3:96656917-96656939 CTATGATCTTAGCTATCTCTGGG + Intergenic
959149231 3:102588748-102588770 TTATGATAATAACTATAGTTTGG + Intergenic
959619120 3:108381024-108381046 ATATAAATATAGCTATAGTTAGG - Exonic
964380888 3:156098095-156098117 CTATCATTGTAGCCATAGTTTGG + Intronic
964812674 3:160682790-160682812 CAATGAATTTAGCTATAATGTGG + Intergenic
967110711 3:186291095-186291117 CTTTGTTTTTAGGTACAGTTAGG - Intronic
967409300 3:189151414-189151436 GCATGGTTTTAGCTATATTTAGG - Intronic
967471756 3:189870010-189870032 TTAGGAGTTTAGCTTTAGTTGGG - Intronic
971568226 4:28172941-28172963 CCATGTTTTTGGCTACAGTTTGG - Intergenic
974192251 4:58521151-58521173 GTATGATTATTGATATAGTTTGG + Intergenic
978597720 4:110396494-110396516 CCAACATTTTAGCTATAATTAGG + Intronic
981398304 4:144280707-144280729 CTATTATTTTTGCTACATTTTGG + Intergenic
981605511 4:146536272-146536294 CTATGGATTTAGCTATAGGTTGG - Intergenic
982714957 4:158797185-158797207 CTTTAATTATAGCTATATTTTGG + Intronic
987822419 5:22982927-22982949 GTATGTTTTTAGCTAGAGTGAGG - Intergenic
994026869 5:95094713-95094735 CTATGTTTTTATTTATAGTTTGG - Intronic
994879477 5:105469700-105469722 CTGTGATTTTAGATTTTGTTAGG - Intergenic
995281881 5:110345119-110345141 GTACGATGTTTGCTATAGTTTGG + Intronic
995939502 5:117564154-117564176 CTATTATTTTAGTTATCCTTTGG + Intergenic
995962858 5:117865102-117865124 GTGTGATTTTTGCTTTAGTTTGG - Intergenic
996499231 5:124198463-124198485 CTATCATTTTAGTGATAGATGGG - Intergenic
1000440696 5:161259693-161259715 CCATGATTTCAGCTATTCTTGGG + Intergenic
1000465962 5:161577014-161577036 GTATGTTTTTAGATATATTTCGG + Intronic
1000855175 5:166388982-166389004 CTATGATCTCAGATTTAGTTGGG + Intergenic
1001359295 5:171065034-171065056 CTAGGATTTTAGTCATAGTTAGG + Intronic
1008292505 6:49734615-49734637 CTAAGATTTTAACAATAGATTGG + Intronic
1008904683 6:56663127-56663149 ATATGGTTTTACCTACAGTTTGG - Intronic
1009195495 6:60679535-60679557 GTATTATTTTGGCTATAGTGTGG - Intergenic
1009320119 6:62277731-62277753 CTTATATTTTAGTTATAGTTTGG - Intronic
1009911425 6:69934099-69934121 CTATGCTTTAAGCTATGCTTTGG - Intronic
1010318407 6:74477608-74477630 CTAAGATCTTAACTAGAGTTAGG - Intergenic
1010449264 6:75984633-75984655 ATATCATTTTTGATATAGTTTGG + Intronic
1010729544 6:79375217-79375239 CTATGATTTTGGTTATACTGTGG - Intergenic
1010837678 6:80610413-80610435 CTAAGATTTCTGCTATACTTAGG + Intergenic
1013466700 6:110423827-110423849 CTATGGTTTTAAGTAGAGTTGGG + Intergenic
1013771392 6:113631850-113631872 CTATGATTTTATCTAACTTTAGG - Intergenic
1014066046 6:117126845-117126867 CCATGGTTTTAGCTATAATTGGG - Intergenic
1014117875 6:117686690-117686712 TTATCATTTTGGCTTTAGTTTGG + Intronic
1016833266 6:148453587-148453609 CTTTGATTGTACCTGTAGTTGGG - Intronic
1020748249 7:12106297-12106319 CTATTATTTTAACTATAATTAGG - Intergenic
1021321017 7:19211647-19211669 AAATGATTTTTGCTTTAGTTCGG + Intergenic
1021543247 7:21783883-21783905 CTAAAATTTTATTTATAGTTAGG + Intronic
1024374489 7:48621671-48621693 CAATGATTTTAACTTTAGATTGG + Intronic
1024633817 7:51270248-51270270 CTCTGAGTTTTGCTATATTTGGG - Intronic
1026654148 7:72242080-72242102 CTATGAATTTAGCTATTCTAGGG + Intronic
1030239832 7:107310143-107310165 ACATGATATTAACTATAGTTTGG - Intronic
1030816723 7:114048425-114048447 CTTTCATTTTACCTATAGGTTGG - Intronic
1042608721 8:70574808-70574830 CTTTGATTTTTGCTATTGTACGG - Exonic
1044492185 8:92832475-92832497 CTATGATTTTTTCTCTAGTATGG + Intergenic
1044494568 8:92861588-92861610 CTCTGATTTTTTCTACAGTTGGG - Intergenic
1046241307 8:111497993-111498015 CGATGATTTTAACTATATTGTGG + Intergenic
1048381919 8:133872832-133872854 CCATGTTTCCAGCTATAGTTTGG + Intergenic
1048383940 8:133893621-133893643 CTCTGTTTTTAGCTACAGTTTGG + Intergenic
1050894327 9:10867892-10867914 CTATGATTGTAACTAAACTTAGG - Intergenic
1052648197 9:31266399-31266421 CAATGATTTTGACTACAGTTGGG + Intergenic
1055904091 9:81272635-81272657 GTATAAAATTAGCTATAGTTCGG - Intergenic
1058136152 9:101309733-101309755 GTATGATCTTAGCTATACTGTGG - Intronic
1059013699 9:110491017-110491039 TTATGATTTAAACTATAATTTGG + Intronic
1059777986 9:117495381-117495403 GTATGATTGTAGCTTTGGTTTGG + Intergenic
1186061985 X:5718969-5718991 CTGTGATTTTAGCTTTAGGCTGG + Intergenic
1188885936 X:35548801-35548823 CTACTAATATAGCTATAGTTTGG + Intergenic
1189830809 X:44971445-44971467 ATATGATTTTATATATATTTTGG + Intronic
1192633535 X:72795584-72795606 TTATGAATTTTGCTATTGTTTGG + Intronic
1192648175 X:72925217-72925239 TTATGAATTTTGCTATTGTTTGG - Intronic
1196898753 X:120362686-120362708 CTATGATTTTAGCTATAGTTTGG - Intronic
1196908524 X:120462619-120462641 TTATGTTTTCAGCTATACTTTGG - Intronic
1198949238 X:142051034-142051056 ATATGATTTTTGATATACTTAGG - Intergenic
1199313112 X:146344653-146344675 CTATGATTTTAGCTATTTCTGGG - Intergenic
1199531021 X:148847702-148847724 CCTTGATTGTAGCAATAGTTAGG + Intronic
1201508275 Y:14728880-14728902 TTATCATTTTAGCTATTTTTTGG - Intronic