ID: 1196898756

View in Genome Browser
Species Human (GRCh38)
Location X:120362706-120362728
Sequence TAGAATCCCCAATAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196898752_1196898756 26 Left 1196898752 X:120362657-120362679 CCAGCTGCTCTCTTTCTAAAGTA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 97
1196898753_1196898756 -3 Left 1196898753 X:120362686-120362708 CCAAACTATAGCTAAAATCATAG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196898756 Original CRISPR TAGAATCCCCAATAGGAGCA GGG Intronic
900605261 1:3521021-3521043 TAGACTCCCCACTAGCAGCTTGG - Intronic
901234667 1:7661516-7661538 CAGAACCCCCGATGGGAGCAGGG + Intronic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
903573823 1:24325505-24325527 TAAAACCCCCAATAAGACCAAGG - Intronic
905782103 1:40720931-40720953 TTGAATCCCCACTATGTGCAAGG + Intronic
910223296 1:84911629-84911651 AACAATCCACCATAGGAGCATGG - Intergenic
914970103 1:152301342-152301364 AATAATACCCAATAGGTGCAGGG - Intergenic
916608705 1:166368578-166368600 TTGAATCCCCACTAGGTACAAGG + Intergenic
922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG + Intergenic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG + Intergenic
1075654058 10:124149751-124149773 TAGCAGCCACAATAGGAGCTAGG - Intergenic
1077528313 11:3082274-3082296 TAAAATACCCAAAAGGAGGAGGG - Intergenic
1079756921 11:24275557-24275579 TAGAATCTTCACTGGGAGCATGG - Intergenic
1080241132 11:30128403-30128425 TGGGATCCCCCAAAGGAGCAAGG + Intergenic
1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG + Intergenic
1089443726 11:118535188-118535210 TAGAATTCCCAAGAGGAGGTGGG - Exonic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1093371395 12:18370152-18370174 TGGCATCCCTAATAGGGGCAGGG - Intronic
1094608944 12:31974558-31974580 TAGTATCCCCCATAGGAAGAGGG - Intronic
1095916473 12:47485110-47485132 TTGAATCTCCTATAGGAGAATGG + Intergenic
1099746053 12:86706697-86706719 TAGAATCCCCAAATGGCACAAGG + Intronic
1100915268 12:99413790-99413812 TGCAATCCCACATAGGAGCAAGG + Intronic
1100959685 12:99948550-99948572 TTGAATTCCCAATATGTGCAAGG - Intronic
1101315892 12:103628546-103628568 TAGAAGCTTCAAAAGGAGCATGG - Intronic
1102849098 12:116221875-116221897 TCAAATCCCCATAAGGAGCAAGG + Intronic
1107899280 13:44995985-44996007 TGTAATCCCCAATACTAGCAGGG + Intronic
1108605978 13:52039018-52039040 TGGAATAACCAATAGGAGCCAGG + Intronic
1108921995 13:55687510-55687532 TAGAGTCACCAAAAGGAGCGTGG - Intergenic
1116254235 14:42529874-42529896 CAGAATACCCAATAGGATAATGG - Intergenic
1117449109 14:55833816-55833838 TAGAAACCCCACTAGGCGCTTGG + Intergenic
1123721260 15:23063840-23063862 TAAAATCTCCCAGAGGAGCATGG - Intergenic
1129570775 15:76681892-76681914 TAAAATCTCCTAGAGGAGCATGG - Intronic
1133669721 16:8006622-8006644 AAGAATCCCGAAAAGGAGAATGG - Intergenic
1134041983 16:11076061-11076083 TAGAATCCCCACCAGCTGCAGGG - Intronic
1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG + Intronic
1150651304 17:67012072-67012094 AAGAATCCTCTATAGAAGCAGGG - Intronic
1150948480 17:69774907-69774929 TAGAATCTCCAAATGGAGCCTGG + Intergenic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1156654695 18:39271439-39271461 TAGAAACAGCAATAGGAGAAGGG - Intergenic
1159135174 18:64329094-64329116 TAGAAGCCCCAATTAGAGGATGG - Intergenic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1161584566 19:5098178-5098200 TAGAAGCCCCATTAACAGCAGGG + Intronic
1164170376 19:22719815-22719837 AACAATGCCCAATATGAGCAGGG + Intergenic
1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG + Intronic
924993426 2:336190-336212 TAGAGCCCCCAAAAGAAGCAGGG + Intergenic
928692442 2:33814550-33814572 TAGAAGCCCAAATGGGAGCAAGG - Intergenic
937120021 2:119434596-119434618 TGGAAGCCCCACCAGGAGCATGG + Intronic
937314557 2:120922750-120922772 TGGAATCCCCAGGAGGAGCCTGG - Intronic
939011031 2:136846053-136846075 TAGACTTCCCAAGACGAGCAAGG + Intronic
944389088 2:199198522-199198544 TAGAATAGTCAACAGGAGCAGGG - Intergenic
1171140321 20:22735201-22735223 TAGACTCACCACTAGGGGCAGGG + Intergenic
953500603 3:43429801-43429823 TAAATTCCTCAATAGGAGAATGG - Intronic
955897613 3:63717403-63717425 TAGAACCCCCAGGAGGAACACGG - Intergenic
956032144 3:65050107-65050129 TAGAGTCTCCAAAGGGAGCATGG - Intergenic
956916912 3:73881245-73881267 TAGAATCTTCAAAGGGAGCATGG - Intergenic
958530176 3:95319257-95319279 TAGATTCCCTAATATAAGCAAGG + Intergenic
967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG + Intronic
967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG + Intergenic
968280530 3:197473670-197473692 TAGAATCCCAAATAAAGGCAAGG - Intergenic
971906011 4:32726912-32726934 CACAATCTCCAATCGGAGCAGGG - Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG + Intronic
976699830 4:87957978-87958000 TAGCATTACCATTAGGAGCAAGG - Intergenic
979306269 4:119147876-119147898 TAGAAAGCCCAAGAGGAGAAGGG + Intronic
981389085 4:144166875-144166897 AAGGATCCCAAATGGGAGCATGG - Intergenic
982316628 4:154038168-154038190 TAGAATCGCTAATATGAGAAGGG + Intergenic
987046723 5:14115829-14115851 TAGGAGCCCCATGAGGAGCATGG - Intergenic
990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG + Intronic
996348061 5:122509030-122509052 TTAAATCCTCAATAAGAGCAAGG + Intergenic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1004862993 6:19824697-19824719 TAAAAACCCCAAGATGAGCAGGG - Intergenic
1007968805 6:46029869-46029891 TTTAATCCCTAACAGGAGCAGGG - Intronic
1016387212 6:143540145-143540167 TGGAATCAAAAATAGGAGCAAGG - Intronic
1022197742 7:28084995-28085017 TAGAGTCCCCACTTGGAGGAAGG + Intronic
1028545970 7:92000146-92000168 TAGAATCCCAAATAAGAACTGGG + Intronic
1029617359 7:101667470-101667492 TAGAAGCTCCAAGAGGATCAGGG - Intergenic
1031974179 7:128083553-128083575 TAGAATCCCCAATGCATGCAGGG - Intronic
1032745798 7:134784727-134784749 CAGAAGCCCAAATAGGACCAGGG + Intronic
1038649843 8:29392588-29392610 TAGAATCACCAACAATAGCAGGG - Intergenic
1040375185 8:46817917-46817939 TACAATCCCCAGTGGAAGCAGGG - Intergenic
1042554854 8:70025441-70025463 CAGAATCCCCAAGAGAGGCAGGG - Intergenic
1044618180 8:94163504-94163526 GAGCATCCCCCAAAGGAGCAAGG - Intronic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1054992206 9:71341580-71341602 TTGAATGCTCAATAGGAGAAGGG + Intronic
1056575527 9:87853443-87853465 AAGTGTCCCCAAGAGGAGCATGG + Intergenic
1059522488 9:114956728-114956750 TAGAATACCCACTTGGAGCCAGG - Intergenic
1186154657 X:6712619-6712641 CAGAATCCCCAAGATGAACATGG - Intergenic
1192375392 X:70555097-70555119 TAGAATCAATAATAGCAGCAGGG - Intronic
1194665668 X:96674848-96674870 CATATTCCCCAATAGGAGAACGG + Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1199952778 X:152718654-152718676 TAGAATCCCCACTACTACCAGGG - Intergenic
1199956905 X:152749794-152749816 TAGAATCCCCACTACTACCAGGG + Intergenic
1200855347 Y:7932037-7932059 TACAATCACCAACAGAAGCAGGG + Intergenic
1200858493 Y:7964908-7964930 TATAATCCCCAGTGGAAGCAGGG + Intergenic
1200902884 Y:8450737-8450759 TACAATCCCCAATGGAAGCAGGG - Intergenic
1202260716 Y:22967432-22967454 TATAATCCCCAGTGGAAGCAGGG - Intergenic
1202413703 Y:24601173-24601195 TATAATCCCCAGTGGAAGCAGGG - Intergenic
1202457082 Y:25068913-25068935 TATAATCCCCAGTGGAAGCAGGG + Intergenic