ID: 1196900103

View in Genome Browser
Species Human (GRCh38)
Location X:120374318-120374340
Sequence GGTGCTACTGAACCACGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196900102_1196900103 -7 Left 1196900102 X:120374302-120374324 CCAGGTCGGGAGGTGGGGTGCTA 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1196900103 X:120374318-120374340 GGTGCTACTGAACCACGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 71
1196900099_1196900103 -1 Left 1196900099 X:120374296-120374318 CCATTGCCAGGTCGGGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1196900103 X:120374318-120374340 GGTGCTACTGAACCACGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 71
1196900094_1196900103 8 Left 1196900094 X:120374287-120374309 CCTCTGGATCCATTGCCAGGTCG 0: 1
1: 0
2: 1
3: 10
4: 76
Right 1196900103 X:120374318-120374340 GGTGCTACTGAACCACGAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196900103 Original CRISPR GGTGCTACTGAACCACGAGC AGG Intronic
903028107 1:20443727-20443749 GGTGCCATTGAACCATGATCTGG + Intergenic
911070798 1:93830504-93830526 GGAGCTTCTGAGCCAGGAGCAGG - Intronic
924482997 1:244453538-244453560 GGGGCCACTGAACCACGAGTAGG - Intergenic
924809003 1:247384633-247384655 GCTGCCACTGAACCATGGGCAGG + Intergenic
1064264036 10:13809942-13809964 GGTGCCACTGAAGCAAGAACAGG - Intronic
1073683240 10:105727760-105727782 GGTGCTTCTGAGCCAGGAGAAGG - Intergenic
1077847302 11:6039531-6039553 GGCGCTACAGAACCAGGAGAAGG - Intergenic
1078298433 11:10100359-10100381 GGGGCTACTGAACCACAGGCAGG - Intronic
1078665878 11:13324745-13324767 GGTGATCCTGAAACACGAGGTGG + Intronic
1080028717 11:27638355-27638377 GGGGCTACTGAACCACGGGCAGG + Intergenic
1083503803 11:63136749-63136771 GGGGCCACTGAACCATGGGCAGG - Intronic
1090952625 11:131486999-131487021 GGTGCTACTGAATGAAGAACTGG - Intronic
1093616701 12:21233871-21233893 AGGGCTACTGAACCATGGGCAGG + Intronic
1094431535 12:30374820-30374842 GGGGCCACTGAACCATGGGCAGG + Intergenic
1101148706 12:101865509-101865531 GGGGCTACTGAACCACAGGCAGG + Intergenic
1105575469 13:21646981-21647003 GCTGCTACTGAACCACTCTCTGG - Intergenic
1105729890 13:23202009-23202031 GCTGCTACTGAAAGATGAGCAGG + Intronic
1105733682 13:23245993-23246015 GGTATTGCTGAACCAAGAGCTGG - Intronic
1106516864 13:30464385-30464407 GGGGCCACCGAGCCACGAGCAGG - Intronic
1107446267 13:40472637-40472659 GGTGCTTCTGAATCACCAGGCGG + Intergenic
1113739576 13:112701953-112701975 TGTGCTCATGAACCACCAGCTGG - Intronic
1121452257 14:94016479-94016501 GCTGCTCCTGAGCCAAGAGCAGG - Intergenic
1122461181 14:101897036-101897058 GGTGCTACAGAGCCACGAGCTGG + Intronic
1125647641 15:41285541-41285563 GGTGCTTCTGAGCCAGGAGATGG + Intergenic
1128351727 15:66895243-66895265 GGGGCCACTGAACCAGGGGCAGG + Intergenic
1136673551 16:31878706-31878728 GGTGCTATTGAGCCATGAGCAGG - Intronic
1137452567 16:48590528-48590550 GGTGCTACCAAACCACAGGCAGG - Intronic
1149992395 17:61390315-61390337 GGTGATACTGAAGGAGGAGCAGG + Intronic
1150594105 17:66589164-66589186 GGAGCTACTCACCCATGAGCTGG - Intronic
1150997325 17:70333691-70333713 GGTGCTACTGAACATATAGCAGG + Intergenic
1156591130 18:38489893-38489915 GGAGCTCCTGAGCCACGAGAAGG - Intergenic
1158869163 18:61667582-61667604 TGAGCTACAGAACCAGGAGCTGG + Intergenic
1160193344 18:76733135-76733157 GGGGCCACTGAACCATGGGCGGG + Intergenic
1160275969 18:77436310-77436332 GTTGCTACTGTACCTCGAGATGG - Intergenic
1163901477 19:20104659-20104681 GGTGCTACTGAATCAAAAGTTGG - Intronic
1165954483 19:39493593-39493615 GGTGCTTCTGAGCCAGGAGAAGG - Intronic
930528814 2:52565616-52565638 GGTGCTACTGCAATAGGAGCTGG - Intergenic
939932758 2:148255044-148255066 GGTGGTACAGAACCAACAGCTGG + Intronic
940330716 2:152471562-152471584 GCTGCTACAGAACCAGGCGCCGG - Intronic
940400192 2:153240450-153240472 AGGGCTACTGAACCACAAGCAGG - Intergenic
941878028 2:170454624-170454646 GGGGCTACCGAACCACGGGCAGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1173982596 20:47236410-47236432 GGTGCTCATGGACCCCGAGCTGG + Exonic
1182429999 22:30293755-30293777 GGTGCTGCTGAAGCACGCGCTGG - Exonic
949999006 3:9641980-9642002 GGGGCTACTGAACCACAGGCAGG + Intergenic
952852675 3:37741781-37741803 GGTGCCACTGATGCACGAGGTGG + Exonic
953612693 3:44460886-44460908 GGGGCCACTGAACCATGGGCAGG - Intronic
961820003 3:129571156-129571178 GGAGCTACTGGACCCCGAGGAGG - Exonic
965869563 3:173249718-173249740 GGAGCTACTGAACCACAGGCAGG + Intergenic
966852881 3:184175369-184175391 GGTGCCACTGAACTAAGAGGAGG - Intronic
969659046 4:8515682-8515704 GGTGCTCCTGACCAAGGAGCAGG + Intergenic
977526799 4:98155968-98155990 GAGGCTACTGAACCATGGGCAGG - Intergenic
989631086 5:43483619-43483641 GGTGCGTGTGACCCACGAGCCGG - Intronic
990969689 5:61490785-61490807 GGTGCTCCTGATCCAACAGCAGG + Exonic
997788975 5:136739383-136739405 GGAGCTTCTGAACCAGGAGAAGG - Intergenic
998522250 5:142811838-142811860 GGTGCTACTGAAGCCAGAGCAGG - Intronic
998870649 5:146548367-146548389 GATTCTACTGCACCACGAGCAGG - Intergenic
1003959850 6:11198826-11198848 GGTTCTACTTAACCCAGAGCTGG - Intronic
1006315729 6:33290376-33290398 GGTGCTAGTCAAACAGGAGCTGG + Exonic
1007781145 6:44255518-44255540 GGTGCTAATGAACCGAGTGCTGG - Exonic
1016742447 6:147542276-147542298 GGAGCCACTGAACCAGGGGCAGG + Intronic
1018801578 6:167226922-167226944 GGGGCTACTGAACCATGGGCAGG - Intergenic
1018987662 6:168649866-168649888 GGTGCTACTGCCCCAGTAGCTGG - Intronic
1019120417 6:169799497-169799519 GGTGCTGCTCAACCAGGAGGTGG + Intergenic
1023800101 7:43826632-43826654 GGGGCCACTGACCCACGGGCAGG - Intergenic
1036037888 8:5040419-5040441 GGGGCCACTGAGCCATGAGCAGG - Intergenic
1042623600 8:70732486-70732508 GGGGCTACTGAACCATGGGCTGG + Intronic
1043706661 8:83358732-83358754 GGATCTACTGAACCATGGGCAGG + Intergenic
1044198090 8:89402441-89402463 GGAGCTGCTGAACCATGGGCAGG - Intergenic
1051114779 9:13682306-13682328 GGTCCTACGCAACCAGGAGCAGG - Intergenic
1051276608 9:15404967-15404989 AGAGGTACTGAACCAGGAGCAGG - Intergenic
1053008020 9:34616926-34616948 GGTGAGACTGAACCACATGCAGG + Intronic
1055679273 9:78698202-78698224 GATGCTACTGATTCAGGAGCAGG + Intergenic
1055848035 9:80591290-80591312 GCTGCTAATGAAGCACAAGCAGG - Intergenic
1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG + Intronic
1057758830 9:97856882-97856904 GTTGCTACTGAACACCTAGCAGG - Intergenic
1059689924 9:116675077-116675099 GGGGGCACTGAACCATGAGCAGG - Intronic
1061830891 9:133293599-133293621 GGGGCTACCAAACCACGGGCAGG + Intergenic
1062703262 9:137919202-137919224 GGTCCTACTGAAACACATGCTGG - Intronic
1189102969 X:38210179-38210201 AGAGCTACTGAATCACAAGCTGG - Intronic
1189204371 X:39225250-39225272 GATGCTACTGAACATGGAGCTGG + Intergenic
1189757412 X:44285060-44285082 GGTACTGCTGAACCAAGAGCTGG - Intronic
1189833200 X:44995827-44995849 CGTGCTGCTGAACCACAAACTGG - Intronic
1196900103 X:120374318-120374340 GGTGCTACTGAACCACGAGCAGG + Intronic
1197793732 X:130279950-130279972 GGTGCTTCTGAGCCAGGAGAAGG - Intergenic
1200292596 X:154886758-154886780 GGTGCGTCTGCACCTCGAGCTGG + Exonic
1200339440 X:155382498-155382520 GGTGCGTCTGCACCTCGAGCTGG + Exonic
1200347030 X:155458195-155458217 GGTGCGTCTGCACCTCGAGCTGG - Exonic