ID: 1196908081

View in Genome Browser
Species Human (GRCh38)
Location X:120458509-120458531
Sequence GAGAAACACCCTGAGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196908078_1196908081 -8 Left 1196908078 X:120458494-120458516 CCGTAAACAAGAGCTGAGAAACA 0: 1
1: 0
2: 3
3: 20
4: 291
Right 1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1196908076_1196908081 1 Left 1196908076 X:120458485-120458507 CCTGGTGGCCCGTAAACAAGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1196908077_1196908081 -7 Left 1196908077 X:120458493-120458515 CCCGTAAACAAGAGCTGAGAAAC 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196908081 Original CRISPR GAGAAACACCCTGAGGGTTC TGG Intronic
902057661 1:13615651-13615673 GATAAACACCTGGAGGGTTGAGG + Intronic
902341100 1:15784254-15784276 GGGAAGTCCCCTGAGGGTTCAGG - Intronic
902435527 1:16396011-16396033 GGGAACCACCCTGAGGGGTATGG - Exonic
904158670 1:28505921-28505943 CAGAAACTCACTGAGGCTTCTGG - Intronic
905106180 1:35564879-35564901 GAGAGAACCCCTCAGGGTTCTGG - Intronic
913154253 1:116079153-116079175 GAGAAGGATCCTGAGGATTCTGG + Intergenic
914816569 1:151067396-151067418 GAGAAAAACCCTGAAGGTGATGG + Exonic
915318932 1:155045504-155045526 GGGAAACTCCTTGAGGTTTCAGG - Intronic
915492929 1:156261477-156261499 AAGCACCACCCTGAGGGATCTGG + Intronic
917152351 1:171958480-171958502 GAGAAACACTGTGAGGTTGCTGG + Intronic
921526389 1:216223542-216223564 AAGTAACATCCTGACGGTTCGGG + Intronic
921808181 1:219479797-219479819 AAGAGACCCCATGAGGGTTCAGG + Intergenic
922741387 1:228016133-228016155 GATAATCACCCTGGGGGGTCAGG - Intronic
1065299956 10:24312246-24312268 GAAAAACACATTGAGGCTTCCGG - Intronic
1065505540 10:26426790-26426812 GAGAGACTCCCTGGGGGTCCTGG + Intergenic
1066314039 10:34225800-34225822 GAGAAAAATCCTCATGGTTCTGG + Intronic
1066678955 10:37917644-37917666 GAGAAACAGCCTGAGAAATCAGG - Intergenic
1067770942 10:49124625-49124647 GAGAAACATGATGAGTGTTCAGG - Intergenic
1068090252 10:52424732-52424754 TAGAAACACCATGAGGTTTCGGG - Intergenic
1069865556 10:71500667-71500689 GATAAAAACCATGAGGGTTGTGG + Intronic
1070430321 10:76331302-76331324 GATGAACAACCTGATGGTTCTGG + Intronic
1073072737 10:100805321-100805343 GAGGAACACCCTGGGGCCTCCGG + Intronic
1073098439 10:100994787-100994809 GAGAAACACGGAGAGGGTACAGG - Intergenic
1075228009 10:120646906-120646928 AAGAGCCACCCTGAGGGTTAGGG - Intergenic
1077926191 11:6683665-6683687 GAAAGGCACCCGGAGGGTTCGGG + Intergenic
1079538440 11:21543107-21543129 GAGAAAATCCATGAGTGTTCTGG - Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1086158629 11:83695881-83695903 GTGAAACAACCTGAAGGTTATGG + Intronic
1088788789 11:113205772-113205794 CAGAAACCACATGAGGGTTCGGG - Intronic
1090334165 11:125951565-125951587 GACAAACTCCCTGGGGCTTCCGG - Intergenic
1091170932 11:133519024-133519046 CAGGAACATCCTGAGGGCTCAGG + Intronic
1092789431 12:12058964-12058986 GAGAAAGAGGCTGAGGGTTAGGG - Intronic
1093271958 12:17074340-17074362 GAAAAACACTCTAAGGGATCTGG + Intergenic
1096656076 12:53093077-53093099 GAGAAACTACCAGGGGGTTCTGG + Intergenic
1103746378 12:123127311-123127333 GAGTAACACCCGGACAGTTCAGG - Intronic
1107672715 13:42762522-42762544 GATAAACACACAGAGGGTTGAGG + Intergenic
1108014278 13:46057714-46057736 GACCAAAACCCTGAGGGTTAGGG + Intronic
1109209069 13:59513827-59513849 GTGGAACACCCTCTGGGTTCAGG + Intergenic
1109211905 13:59544954-59544976 AAGAAACACCCTGAGGCTGCTGG + Intergenic
1111700338 13:91679501-91679523 CAAAAACACTCTGAGGTTTCCGG - Intronic
1112225134 13:97532219-97532241 AAGAAACTCCCTGATGATTCAGG + Intergenic
1112570893 13:100592029-100592051 GAGAAACACCCAGAGGAGGCTGG - Intergenic
1115620426 14:35135113-35135135 GAGAAAGACTCTGAGTGTTTGGG - Intronic
1117964803 14:61195898-61195920 TAGAAGCACCCTGGGGGTTAGGG + Intronic
1118899193 14:69972583-69972605 GAGAAAAATGCTGAGGGCTCTGG + Intronic
1121111754 14:91317586-91317608 GAGAACCACCCTGCAGGGTCGGG + Intronic
1121951201 14:98172341-98172363 GAGAATCACCCTGTGTGCTCTGG - Intergenic
1128005215 15:64232898-64232920 GACACAGACCCTGAAGGTTCTGG - Intronic
1128365111 15:66994151-66994173 CAGAAACAGCCTGGGGTTTCAGG - Intergenic
1130060471 15:80566301-80566323 GAGAATCACCAGGAGGGTCCTGG - Intronic
1130868454 15:87951810-87951832 AAGAAAGACCCTTAGGGTTAAGG - Intronic
1132175917 15:99714500-99714522 GAGAAACACTCTTAGGGTGCTGG + Exonic
1132186207 15:99804061-99804083 GAGAAAATCTCTGGGGGTTCAGG + Intergenic
1132429466 15:101748642-101748664 GAGAAAATCTCTGGGGGTTCAGG - Intergenic
1133314559 16:4874664-4874686 GAGAAAAAACCAGAGAGTTCTGG + Exonic
1135553362 16:23415482-23415504 GAGAAACAGCTGGAGGGTTTGGG - Intronic
1136719904 16:32311307-32311329 GAGAAACAGGCTGAGCGTGCTGG - Intergenic
1136838278 16:33517586-33517608 GAGAAACAGGCTGAGCGTGCTGG - Intergenic
1137293120 16:47065833-47065855 GAGGCCCACCCTGAGGGCTCTGG + Intergenic
1137399062 16:48138539-48138561 GAGGAACACCATGGGGGGTCAGG + Intronic
1139557894 16:67724220-67724242 GATAAACCCCATGAGGGGTCAGG - Exonic
1139770433 16:69270771-69270793 TAGAAACACCCTGTGGCTTCAGG - Intronic
1140743674 16:77962962-77962984 AAGAAACAATCTTAGGGTTCTGG + Intronic
1141494413 16:84397186-84397208 GTGAAACACCTGGAGGCTTCGGG - Intronic
1141993926 16:87625322-87625344 GAGGGAAACACTGAGGGTTCAGG - Intronic
1203006527 16_KI270728v1_random:206462-206484 GAGAAACAGGCTGAGCGTGCTGG + Intergenic
1148025565 17:44585267-44585289 GAGAAAGACCCTGAAGGATATGG - Intergenic
1151605912 17:75135696-75135718 GAGAGACTCCCTGTGGGTTGGGG + Exonic
1152663592 17:81554270-81554292 GAGAAAAACCATGAAGCTTCAGG + Intergenic
1153159708 18:2190090-2190112 TCCAAATACCCTGAGGGTTCAGG - Intergenic
1154213707 18:12400215-12400237 GAGAAGCTCCCTGAGGATTCCGG - Intergenic
1155095270 18:22549379-22549401 AAGAAATACCCTGAGGGCACTGG - Intergenic
1157792898 18:50548785-50548807 GAGAAATACCGTGAGGGTGCTGG - Intergenic
1160007082 18:75075534-75075556 GGGACGCAACCTGAGGGTTCAGG - Intergenic
1162934578 19:13975276-13975298 GAGAACCACCCTGAAGGTGGAGG + Intronic
1165490252 19:36119332-36119354 AAGGAACACCCTGAGGTGTCTGG - Intronic
1166566629 19:43769588-43769610 GAGATAGACCCTTACGGTTCTGG + Intronic
927792425 2:26020692-26020714 GAGAAACAGGCTCAGGGATCTGG + Intergenic
929668720 2:43852959-43852981 GAGAAACTCCCAGAGGTTTCAGG + Intronic
929998666 2:46846524-46846546 GAGAGAAACCCCAAGGGTTCTGG + Intronic
931383023 2:61770995-61771017 AAGATACAACCTGAGGGTTGAGG + Intergenic
931813709 2:65879716-65879738 GAGAAATGCCCTGAGCTTTCTGG + Intergenic
934085872 2:88509107-88509129 GAGAAAAAGCCTGATGTTTCTGG - Intergenic
934502446 2:94871207-94871229 GAGTCCCACCCTTAGGGTTCAGG - Intergenic
941864590 2:170321682-170321704 CAGAAACACACTGAGTATTCAGG - Intronic
941995986 2:171602476-171602498 GAGAAGGGACCTGAGGGTTCCGG - Intergenic
942564773 2:177255421-177255443 GAGAATCATCCTGTGGGTGCAGG - Intronic
947184866 2:227445800-227445822 GAGAAACAGGCTTGGGGTTCTGG + Intergenic
1175622929 20:60465999-60466021 GAGAAGCACACTGAGTGATCCGG + Intergenic
1175723001 20:61298633-61298655 GAGACACACTCTGAGACTTCTGG + Intronic
1175738582 20:61404671-61404693 GTGAAACATCCCGAGGCTTCAGG + Intronic
1176291081 21:5045059-5045081 GTCAATCACCCTGAGGCTTCGGG - Intergenic
1177652751 21:23979367-23979389 GAGAAAAAACATGAGGGTCCTGG - Intergenic
1179836121 21:44034644-44034666 AAGACACATCCTGAGGTTTCAGG - Intronic
1179866174 21:44218582-44218604 GTCAATCACCCTGAGGCTTCGGG + Intergenic
1182095320 22:27621798-27621820 GAAAAGCACCCTGTGGCTTCGGG + Intergenic
1183227994 22:36563425-36563447 GAGGCTCACCCTGAGGATTCCGG + Intergenic
1183304796 22:37076798-37076820 GGGAAACACACTCAGGGTGCAGG + Intronic
1183340345 22:37276961-37276983 GAGAAACAGCATGATGGGTCAGG - Intergenic
1184341006 22:43885911-43885933 GAGGCACACACAGAGGGTTCTGG - Intronic
1185406375 22:50654159-50654181 CAGAAACACCCTGTGGTTACAGG + Intergenic
950204208 3:11065487-11065509 GGGAAACACCCTGACTGTTTTGG + Intergenic
951040831 3:17987424-17987446 GAGAAAAAACCAGAGGATTCTGG + Intronic
951361809 3:21734271-21734293 AAAAAAAACCCTGAGTGTTCTGG - Intronic
951901772 3:27664307-27664329 GAGAATCACCCTGATGTTTGGGG + Intergenic
953305321 3:41823575-41823597 TAGTAACACCCTAAGGTTTCAGG - Intronic
953868992 3:46609899-46609921 GATTAAGACCCTGAGGTTTCAGG + Intronic
954176872 3:48851712-48851734 GTGTAGCACCCTCAGGGTTCTGG - Intergenic
954751073 3:52813997-52814019 CAGACGCACGCTGAGGGTTCAGG - Exonic
959894919 3:111594680-111594702 GAGAAACAGCCTCAGGGTTCAGG + Exonic
961932529 3:130548625-130548647 GAGAAAAACCCTCATGCTTCTGG - Intergenic
962606249 3:137035172-137035194 CAGAAACAGGCTGAGGGCTCAGG - Intergenic
967550608 3:190790353-190790375 GAGAAACACCATGAGAATGCAGG + Intergenic
969321908 4:6417582-6417604 GGGCAACACCCAGAGGGTCCTGG - Intronic
973786247 4:54335357-54335379 AAGAAACACCCTAAGGTTTCCGG - Intergenic
977275914 4:94977184-94977206 GGATAACACCCTGATGGTTCTGG + Intronic
979557415 4:122065466-122065488 GAGAAACACACAGAAGGTTATGG + Intergenic
981694428 4:147545742-147545764 GAGAAACTCCCAGAGGATGCTGG - Intergenic
985120244 4:186633047-186633069 AAGAAGCATCCTGAGGTTTCAGG - Intronic
986728154 5:10615123-10615145 GAGAGACACTCTCAGGGTTCCGG - Intronic
988481194 5:31632332-31632354 AAGAAAGACCCTGTGGGATCAGG - Intergenic
989999859 5:50880151-50880173 GAGAGACTTCCTGAGTGTTCTGG - Intergenic
994732388 5:103507923-103507945 CAGAAACACCCTGGTGGTCCTGG - Intergenic
995565162 5:113426466-113426488 GAAACAAACCCTGAAGGTTCTGG + Intronic
998147865 5:139740497-139740519 GAGAAGAACCCTGAGGCTTCAGG + Intergenic
999309565 5:150543237-150543259 GAGAAACATCCTGAGTCTTGGGG + Intronic
1001328076 5:170744056-170744078 GAGGACAACCCTGGGGGTTCTGG + Intergenic
1001419742 5:171577603-171577625 CAGGAGCACCCTGAGGGTCCAGG - Intergenic
1001889417 5:175326777-175326799 GAGCCCCACCATGAGGGTTCTGG - Intergenic
1004471076 6:15929571-15929593 GAGAAAGATCCTGAATGTTCAGG - Intergenic
1009623183 6:66101739-66101761 GAGAAACCCACTGAGGATTAAGG + Intergenic
1012219873 6:96636494-96636516 GAGAACAAGCCTGAGGGGTCAGG - Intergenic
1015496999 6:133892694-133892716 GAAACACACCCTAAGGGTTATGG - Exonic
1016307547 6:142699319-142699341 GAAAAACACAATGAGGGCTCTGG + Intergenic
1018394602 6:163368370-163368392 GAGAATCACCCATAGGTTTCAGG + Intergenic
1018989471 6:168662572-168662594 GAGAAGCAGCCAGAGGCTTCTGG - Intronic
1023165572 7:37340271-37340293 GACATACACACTGAGTGTTCAGG + Intronic
1033529133 7:142245430-142245452 GAGCAACACCGTGAGGGTGCTGG - Intergenic
1035425935 7:158773183-158773205 GAGAAACAAGCAGAGGGTACAGG - Intronic
1035629949 8:1099480-1099502 CAGAAACTCCCTGAGGGCTGAGG - Intergenic
1036691043 8:10944952-10944974 GGAAAGCACCCTGAGGCTTCTGG + Intronic
1036766229 8:11550783-11550805 GAGAAAACCCCTGAGGGTGATGG - Intronic
1037605995 8:20437488-20437510 GAGAAACATCCCCAGGGTGCAGG + Intergenic
1038008649 8:23456973-23456995 CTGAAGCACCCTAAGGGTTCTGG + Intronic
1041476818 8:58276756-58276778 GGGAGACTCCCCGAGGGTTCAGG - Intergenic
1042051638 8:64715887-64715909 GAGAAACACTCTGTGAGTTCAGG + Intronic
1049315519 8:141964967-141964989 GAGAAAGAGCCTCAGGTTTCTGG + Intergenic
1055996011 9:82160967-82160989 AGGAATCATCCTGAGGGTTCTGG - Intergenic
1057275570 9:93674460-93674482 GAGAAACACTTTGAGGCTCCAGG - Intronic
1057615729 9:96588117-96588139 AAGAAACACTCTGGGGGTCCAGG + Intronic
1059679321 9:116570963-116570985 GAGATACATCCTGAGAGTTTTGG + Intronic
1060862558 9:126966987-126967009 TAGAAACACTTTCAGGGTTCTGG - Intronic
1187417307 X:19104315-19104337 GAGATACACCCTCTGGGTACAGG + Intronic
1188247218 X:27850903-27850925 GAGAAATCCCCTGGTGGTTCTGG - Intergenic
1192220440 X:69194188-69194210 GAGAAACAATCTCAGGGGTCGGG - Intergenic
1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG + Intronic
1197276119 X:124481439-124481461 GGGAGGCACTCTGAGGGTTCTGG + Intronic
1197663788 X:129201280-129201302 CAGAAGCAGCCTGAGGGCTCTGG + Intergenic
1197884904 X:131208483-131208505 GAGAAAAACCCTGAGTGTATAGG + Intergenic
1198331171 X:135624439-135624461 GAGAAACACAGAGAGGATTCAGG + Intergenic
1198335171 X:135658685-135658707 GAGAAACACAGAGAGGATTCAGG - Intergenic
1201188708 Y:11429095-11429117 GAGAAACAGGCTGAGCGTGCTGG + Intergenic