ID: 1196921961

View in Genome Browser
Species Human (GRCh38)
Location X:120594108-120594130
Sequence GCCAAATGGCCTTCCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196921961_1196921968 22 Left 1196921961 X:120594108-120594130 CCAGGAGAGGAAGGCCATTTGGC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1196921968 X:120594153-120594175 TGGAGGAGGGTAGAGCAAGATGG 0: 1
1: 1
2: 11
3: 71
4: 721
1196921961_1196921964 5 Left 1196921961 X:120594108-120594130 CCAGGAGAGGAAGGCCATTTGGC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1196921964 X:120594136-120594158 TCCTGACAGACAAAAGCTGGAGG 0: 1
1: 0
2: 6
3: 100
4: 636
1196921961_1196921963 2 Left 1196921961 X:120594108-120594130 CCAGGAGAGGAAGGCCATTTGGC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1196921963 X:120594133-120594155 GAATCCTGACAGACAAAAGCTGG 0: 1
1: 0
2: 3
3: 22
4: 195
1196921961_1196921966 8 Left 1196921961 X:120594108-120594130 CCAGGAGAGGAAGGCCATTTGGC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1196921966 X:120594139-120594161 TGACAGACAAAAGCTGGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 311
1196921961_1196921967 9 Left 1196921961 X:120594108-120594130 CCAGGAGAGGAAGGCCATTTGGC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 1196921967 X:120594140-120594162 GACAGACAAAAGCTGGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196921961 Original CRISPR GCCAAATGGCCTTCCTCTCC TGG (reversed) Intronic
901327950 1:8380213-8380235 GGCAAAAGGCCTGCCTCTCTTGG + Intronic
901642269 1:10698764-10698786 CCAAACTGGCCTTCCTCTCGTGG + Intronic
901922971 1:12549134-12549156 GCCATGTAGCCATCCTCTCCCGG - Intergenic
902678544 1:18026789-18026811 CCCAACTGGCCTTCTTATCCTGG + Intergenic
902928804 1:19715982-19716004 CCCAAATGGCCTTGCCCTCCAGG - Intronic
903373488 1:22851701-22851723 GCCTCATCTCCTTCCTCTCCTGG + Intronic
904071274 1:27799691-27799713 GCCAGATGGTCTCCATCTCCTGG + Intronic
906282682 1:44565237-44565259 CCCAACTGGCCTTATTCTCCTGG - Intronic
907395461 1:54186644-54186666 TCCAAATGGCCTGCTTCCCCAGG - Intronic
911991982 1:104709971-104709993 GTCAAATGTCCTTCTTCTCTAGG + Intergenic
912561784 1:110556294-110556316 GCCAAATGCCCGCCCACTCCTGG + Intergenic
912744697 1:112236017-112236039 GCCATATTCCCTGCCTCTCCAGG - Intergenic
913130470 1:115834164-115834186 GCAAAACAACCTTCCTCTCCAGG - Intergenic
914750901 1:150534286-150534308 GACAAAGGGCATCCCTCTCCAGG - Intergenic
915740218 1:158113546-158113568 GGCAATTTGCCTTCCTCCCCGGG + Intergenic
916413619 1:164572532-164572554 TCAAAAGTGCCTTCCTCTCCAGG - Intronic
917803641 1:178594026-178594048 GCCAAAGGCCCTTCATCACCTGG - Intergenic
922329944 1:224565645-224565667 GCCAACTGGTCTTACTCTGCAGG + Intronic
924539740 1:244970282-244970304 GCCCAAGGGTCTTCCTCCCCCGG + Exonic
924643775 1:245858089-245858111 CCCATATGGCCATCCTCACCTGG + Intronic
1064157665 10:12916925-12916947 GCCCAATGGACTTGGTCTCCGGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065454325 10:25891495-25891517 GTCACATGGCATTCCTCTTCAGG - Intergenic
1066296682 10:34060126-34060148 GCCAGAGTGCCTTCCTCCCCAGG - Intergenic
1069788558 10:71005039-71005061 GCCATATCGCCTGCCCCTCCTGG - Intergenic
1070539489 10:77406065-77406087 GCCCAGTGGCCTCCCCCTCCTGG - Intronic
1071669582 10:87596173-87596195 GCCAACTGGACTCTCTCTCCAGG - Intergenic
1072280263 10:93859492-93859514 ACCTAAAGTCCTTCCTCTCCTGG + Intergenic
1073316118 10:102582099-102582121 GCCAAATGCCCCTTTTCTCCAGG - Intronic
1081132220 11:39394254-39394276 GCCAAATGGGCTTCATCCCTGGG - Intergenic
1082850135 11:57757002-57757024 GATAAATGGCCATCCTATCCAGG + Intronic
1082993910 11:59233753-59233775 GCCAAATGGCCTCACTCAGCAGG + Intergenic
1086054502 11:82630708-82630730 GCCAACTTGCCTTCCTCTCTTGG - Intergenic
1086876649 11:92104540-92104562 GCAGAATTTCCTTCCTCTCCAGG + Intergenic
1089294581 11:117459963-117459985 GCAGCAGGGCCTTCCTCTCCTGG + Intronic
1091683820 12:2547170-2547192 GCCAGATAGCCTCTCTCTCCTGG + Intronic
1096220242 12:49824514-49824536 GCCAACTGGACCTCCTCTGCAGG - Intronic
1096481405 12:51943707-51943729 GCCAAATGGGATTGCTCTCCTGG - Intergenic
1100225834 12:92554813-92554835 GCCAAATGGACTTCCTTTTCTGG + Intergenic
1102415807 12:112761640-112761662 GACAAATGGGCTGCCTGTCCAGG - Intronic
1102663148 12:114547125-114547147 TCCAGATGGCCTTCTTCTCACGG - Intergenic
1102891061 12:116558960-116558982 TCCAAATGGGCTTCGGCTCCTGG - Intergenic
1104037264 12:125106185-125106207 GACAAATGGACTTTCTCTCAGGG - Intronic
1104799988 12:131547900-131547922 GAGAAGTGACCTTCCTCTCCTGG + Intergenic
1105826266 13:24126171-24126193 GCTACAGGGACTTCCTCTCCAGG + Intronic
1109559167 13:64024572-64024594 GCAAAATGGTCCTCCTTTCCTGG + Intergenic
1113493654 13:110712503-110712525 GCCAAAGGGCCCGCCCCTCCTGG - Intronic
1114366761 14:22035271-22035293 GCCAAATGGCCTGGCTCCCTGGG - Intergenic
1116991004 14:51276546-51276568 GGCAAAAGGGCTTCTTCTCCTGG - Intergenic
1118636066 14:67749864-67749886 GCAAAATGCCCTTCTTCTCTTGG - Intronic
1121503857 14:94461516-94461538 GCCACAGGGCCTTCCTGTGCTGG - Intergenic
1122147266 14:99699081-99699103 CCCAGAAGCCCTTCCTCTCCCGG + Intronic
1123028622 14:105440174-105440196 CCCAAGTGGCCTTGCTCTGCAGG - Intronic
1127361367 15:58247537-58247559 GCCTAATGCCCTGCCTCTGCTGG - Intronic
1127723889 15:61728608-61728630 TCTGAATGGCCATCCTCTCCGGG + Intergenic
1129157005 15:73724494-73724516 GGCCAATCCCCTTCCTCTCCAGG + Intergenic
1130371080 15:83285335-83285357 GACAAATGGCTTTGCTCTCTGGG + Intergenic
1132203864 15:99973293-99973315 GCCAGATGGCGTTCCTCCCCTGG + Exonic
1132235080 15:100213827-100213849 GCCAGATGGCCCTTCTCTACTGG - Intronic
1132717631 16:1299980-1300002 GGCAAATGTCCCTGCTCTCCTGG + Intergenic
1134121229 16:11586534-11586556 GCCCAGGGGCCGTCCTCTCCGGG + Intronic
1134609318 16:15595533-15595555 GTGGAATGGCCTTCCTCTCTAGG - Exonic
1139322280 16:66124925-66124947 ACAAAAGGGCCTTCCACTCCAGG - Intergenic
1143901314 17:10176757-10176779 GCTCAATGGCCTTGTTCTCCAGG + Intronic
1143903694 17:10193636-10193658 TCCACATGGCCTTTCTCTTCAGG - Intronic
1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG + Intergenic
1144442856 17:15299717-15299739 GTTAGATGTCCTTCCTCTCCAGG + Intergenic
1146639565 17:34529963-34529985 GCCAAATGACTTTGATCTCCAGG - Intergenic
1148845255 17:50526213-50526235 GCCGGATGGCCTTCCCCTGCTGG + Exonic
1149325958 17:55530192-55530214 GCCAAATTGGGTTCCTATCCTGG - Intergenic
1149584119 17:57773694-57773716 GCCTCATTTCCTTCCTCTCCTGG - Intergenic
1149899807 17:60464701-60464723 CAAAAATGTCCTTCCTCTCCTGG + Intronic
1149965502 17:61159665-61159687 GACAAAGGGTCTGCCTCTCCAGG - Intronic
1150209554 17:63434643-63434665 GCCAAATGCCCTTTGTATCCTGG + Intronic
1150495911 17:65607657-65607679 GCCAAATGGCCATACTGTGCAGG + Intronic
1150845939 17:68658005-68658027 GTCAAATGGCTTTCCTCCCCAGG + Intergenic
1152404201 17:80087212-80087234 GTCTAAGGGCCTCCCTCTCCTGG + Intronic
1152891206 17:82882605-82882627 ACCCACTGGCCTTGCTCTCCAGG - Intronic
1153943422 18:9996460-9996482 GCCACATGGCCTTCAACTCTGGG + Intergenic
1155628472 18:27863418-27863440 GTCAAATGGCCATCTTTTCCTGG + Intergenic
1157199438 18:45646576-45646598 TCCAAATAGTTTTCCTCTCCTGG - Intronic
1157451486 18:47792369-47792391 TCCAAATGGCTCTCCTGTCCCGG - Intergenic
1157715709 18:49885607-49885629 GCCAACTTTCCTTCCTCTCCTGG + Intronic
1158201531 18:54947097-54947119 GCCATATGGCATTACTATCCTGG + Intronic
1159668015 18:71187811-71187833 GCCAAATTTACTTTCTCTCCTGG + Intergenic
1160104887 18:75964778-75964800 CTCACATTGCCTTCCTCTCCCGG - Intergenic
1163510857 19:17734175-17734197 CCCAAGTCGCCTTCCTTTCCTGG - Intronic
1163969088 19:20775192-20775214 CCCAAATGGCCCTCCTCACTGGG - Intronic
1164466266 19:28489897-28489919 GCCAAAGGGCTTTTCTCTCCCGG + Intergenic
1166215572 19:41332333-41332355 GCCACATGCCCCTCCTCCCCAGG + Intronic
925096167 2:1205641-1205663 ACCTGATGGCCTTCATCTCCAGG + Intronic
926092550 2:10060148-10060170 GGCAGCTGGCCTGCCTCTCCTGG - Intronic
929425474 2:41840757-41840779 GTTAAAAGGCTTTCCTCTCCAGG + Intergenic
932261027 2:70327643-70327665 GCTAAATGACCTTGCTCTACAGG - Intergenic
932839806 2:75071653-75071675 TACAAATGACCTTCCTGTCCAGG + Intronic
934892825 2:98085802-98085824 GCCAAATGCCCTGCCTCACATGG - Intergenic
938072279 2:128315028-128315050 GCCAAATGGCCAGCCATTCCAGG - Intronic
938191030 2:129280804-129280826 GCCAAGTAGCCTCCCACTCCTGG - Intergenic
938689667 2:133776095-133776117 TCCACATGGCCTTACTCTCTAGG - Intergenic
941399131 2:165008871-165008893 GCCTGATAGCCTTCATCTCCAGG + Intergenic
944481497 2:200161913-200161935 GCCAAATGTCTCTCTTCTCCTGG - Intergenic
944690447 2:202153884-202153906 GCCAGTTGGCCTTCCTCTTGAGG + Intronic
947816366 2:233040233-233040255 GCCCTATGGCCTTCCTGGCCGGG + Intergenic
947877573 2:233477915-233477937 GCCAAGTGGCCTGTCTCTCCGGG - Intronic
1169066688 20:2697918-2697940 CCCAGCTGGCCTCCCTCTCCGGG - Intronic
1170338963 20:15301789-15301811 GCCTATTGCCCTTTCTCTCCTGG - Intronic
1170830272 20:19833735-19833757 GCTAACTGGCCTCCCTCCCCAGG + Intergenic
1175161279 20:57009645-57009667 GTCAAATGGCCTTCCACTCTGGG + Intergenic
1177177329 21:17714200-17714222 GCTAAATGGCTCCCCTCTCCAGG - Intergenic
1180700335 22:17778129-17778151 GCCAGGTGGCCTTCCTCTCCCGG + Intergenic
1180750992 22:18124130-18124152 ACCTAATGGTCTTCCTCTCTTGG + Intronic
1181009513 22:20032270-20032292 GCCACACGCCCATCCTCTCCAGG - Intronic
1182356916 22:29726319-29726341 GACATGTGGCCATCCTCTCCGGG + Intronic
1182626965 22:31654587-31654609 ACCAAATGCACTTCCTCTTCTGG + Intronic
1182987486 22:34734148-34734170 GCCAAATGGCCTTCTCCACAGGG - Intergenic
1183600133 22:38835326-38835348 GCCACCCTGCCTTCCTCTCCAGG + Intronic
1184027092 22:41865872-41865894 GCCAAGTTACTTTCCTCTCCTGG + Intronic
1184281656 22:43440884-43440906 TCCATGTGGCCTCCCTCTCCAGG + Intronic
1184429083 22:44430728-44430750 TCAAAAGGGCCCTCCTCTCCGGG + Intergenic
949533910 3:4980629-4980651 ACCAACTGGCCTTCCTTTTCAGG + Intronic
950408388 3:12818491-12818513 GCCAAAACGCCTGCCCCTCCTGG - Intronic
951918243 3:27824211-27824233 GCAAAATGTCCTTCCTCTGAAGG - Intergenic
954104456 3:48402484-48402506 GGCACATGGCCCCCCTCTCCCGG + Intergenic
954795755 3:53160839-53160861 GCCAGCTGGCCCGCCTCTCCTGG - Intronic
955404650 3:58618492-58618514 GCAAGATGGCCTCCCTCTCTGGG - Intronic
955509302 3:59663477-59663499 GACAAATGTCCTTGCTCTCAAGG - Intergenic
958981693 3:100727905-100727927 GCCAACTGGACTTCCCCTCCCGG + Intronic
961402675 3:126658149-126658171 TGCACTTGGCCTTCCTCTCCAGG - Intergenic
961414179 3:126745373-126745395 GTCAAATGGCACACCTCTCCTGG + Intronic
962617141 3:137138030-137138052 GCCAAAGGGCCATCTTGTCCTGG - Intergenic
962662058 3:137612322-137612344 GCCAAATGACTTTCCTTTCTGGG - Intergenic
966251062 3:177865897-177865919 GCCAAATGGTCTTGCTCAGCAGG + Intergenic
973040851 4:45468760-45468782 GCCAAATGCCTATTCTCTCCTGG + Intergenic
975340504 4:73234631-73234653 GCCAACTTGACTTCCTATCCAGG - Intronic
978384619 4:108167616-108167638 GCTAAATCGCCTTCCTCTTCGGG + Exonic
980119985 4:128717860-128717882 GGCAAATGGCCCTCTTCTCAGGG + Intergenic
980322252 4:131293506-131293528 GCCTCATGGCTTTCTTCTCCGGG + Intergenic
980914837 4:139024558-139024580 GCAAAACTCCCTTCCTCTCCAGG - Intronic
985838457 5:2288247-2288269 GCCCAGTGGCCTTCCTGGCCGGG + Intergenic
986350923 5:6878666-6878688 GTCTAAGGGCCTTCCTTTCCTGG + Intergenic
988207622 5:28160494-28160516 GACAAATGGCCTCCCTTTCTTGG - Intergenic
988404405 5:30805476-30805498 GCAAAATTACCCTCCTCTCCAGG + Intergenic
991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG + Intergenic
991495464 5:67221586-67221608 GCCAAATGGCAGCCCACTCCTGG - Intergenic
996836988 5:127804378-127804400 GCCAACTGGACTCTCTCTCCAGG + Intergenic
996849759 5:127938890-127938912 GCCATATGGACTCCCTCTCCTGG + Intergenic
996849777 5:127938980-127939002 GCCATATGGACTCTCTCTCCTGG + Intergenic
999937268 5:156501027-156501049 TCCAAATGTTCTGCCTCTCCTGG + Intronic
1000331755 5:160211335-160211357 GCCCATTGGGCTTTCTCTCCTGG + Intronic
1001550330 5:172598088-172598110 ACCTGATGGCCTTCCTCTCCTGG - Intergenic
1002399617 5:178984359-178984381 GCCATGGGGCTTTCCTCTCCTGG - Intronic
1002472007 5:179440889-179440911 GTCACAGGGCCTTCCTCTCTAGG + Intergenic
1003890485 6:10559714-10559736 CCGCAATGGCCTTCCTCTCCAGG - Intronic
1005139395 6:22610542-22610564 GCCAAATGGGCTTTCTTCCCAGG + Intergenic
1005714598 6:28534834-28534856 GATAAAGGGCATTCCTCTCCAGG - Exonic
1006277729 6:33019553-33019575 GCTAAATAGCTTTCCTCTCATGG + Intergenic
1007219744 6:40269090-40269112 GCCAACTGGCCTGCCCCTACAGG + Intergenic
1007891536 6:45298015-45298037 GTCAAATTGCATTCCACTCCTGG - Intronic
1008016372 6:46525035-46525057 ACCACATGGCCTTATTCTCCGGG - Intergenic
1008900233 6:56605584-56605606 GACAAATGGCTTTCCTCAGCAGG + Intronic
1011892176 6:92177987-92178009 CCCACCTGGCCTTCCTCTGCTGG + Intergenic
1011898952 6:92268304-92268326 GCTAAATTGGCTTCCTATCCTGG + Intergenic
1013632660 6:112000350-112000372 TCCGAAAGGCCTTCCTCCCCTGG - Intergenic
1014775405 6:125503408-125503430 CCCAAATCACCTTCCTTTCCAGG - Intergenic
1016657994 6:146543512-146543534 CCCAGCTGGACTTCCTCTCCCGG - Intergenic
1016658011 6:146543560-146543582 CCCAACTGGACTTCCTCTCCCGG - Intergenic
1016874959 6:148855451-148855473 TCCCACTGGCCTTCCTCACCTGG - Intronic
1018206961 6:161445309-161445331 CCCAAGTGGCCCTCCTCCCCTGG - Intronic
1021923572 7:25512757-25512779 GCCTGTGGGCCTTCCTCTCCTGG - Intergenic
1022702780 7:32777159-32777181 GCCACTTTGCCATCCTCTCCAGG - Intergenic
1024913225 7:54469926-54469948 GCTGCATGGCCTTCCACTCCAGG - Intergenic
1025301446 7:57821970-57821992 GCCAACTGGCGCTCCGCTCCTGG - Intergenic
1026760512 7:73122690-73122712 ACCAAATGGGCTCCCACTCCAGG + Intergenic
1027036854 7:74931511-74931533 ACCAAATGGGCTCCCACTCCAGG + Intergenic
1027086709 7:75269948-75269970 ACCAAATGGGCTCCCACTCCAGG - Intergenic
1028427637 7:90707729-90707751 CCCAAATGTCCTTCTTCTCCTGG + Intronic
1030604204 7:111621984-111622006 GACAAATTGCTTTCTTCTCCAGG - Intergenic
1032307250 7:130746911-130746933 TCCAAATACCCTTCTTCTCCTGG - Intergenic
1032468294 7:132160631-132160653 GCCAAGTGGCCCTCCCCTTCTGG + Intronic
1032547991 7:132759481-132759503 GCCACAGGGGCCTCCTCTCCAGG - Intergenic
1034010917 7:147528633-147528655 GACAAATGGCCTCTCTCTTCTGG + Intronic
1035081770 7:156222222-156222244 GGCAGATGGCCGTCTTCTCCTGG - Intergenic
1036291092 8:7491287-7491309 GGCAGATGGTCTTCCTCCCCAGG + Intergenic
1036330398 8:7820249-7820271 GGCAGATGGTCTTCCTCCCCAGG - Intergenic
1036626931 8:10479922-10479944 GCCAAAGTGCCTTCCTTTGCAGG - Intergenic
1037148788 8:15609384-15609406 GCCATCTGGCCTGCCTCTCTTGG - Intronic
1038661466 8:29501055-29501077 GACAAGTGACTTTCCTCTCCAGG + Intergenic
1039415029 8:37386258-37386280 GCCACAGGGCCCTCCTCTCCTGG - Intergenic
1039947251 8:42140510-42140532 ACCAAATGGCTTTCATCCCCTGG - Intergenic
1041185845 8:55299968-55299990 CCCAGAAGGCCTCCCTCTCCTGG - Intronic
1041681029 8:60591536-60591558 GCAAAATGGCTTTCTTCTCTGGG + Intronic
1041802526 8:61815322-61815344 GCCAAATGACCAGACTCTCCAGG + Intergenic
1044631276 8:94280878-94280900 GCCAAGTTGCCTTCCTCTCTTGG + Intergenic
1049541187 8:143209940-143209962 CCCAAAAGGCCCTACTCTCCCGG + Intergenic
1056319611 9:85424019-85424041 GACACATGGCGTTCTTCTCCTGG - Intergenic
1057583116 9:96305246-96305268 GCCAGGTGGCCGTCATCTCCAGG + Intergenic
1058301751 9:103382087-103382109 TCCATATGGCCTTCCTCTGTTGG + Intergenic
1060207700 9:121692100-121692122 GCCACTTGCCCTTCCTGTCCTGG + Intronic
1060470358 9:123943177-123943199 GCCAAGTGTCTTACCTCTCCTGG - Intergenic
1060531428 9:124349158-124349180 GCACAGTGCCCTTCCTCTCCTGG + Intronic
1060781208 9:126414599-126414621 GCCAGAAGGCCTTCACCTCCTGG + Intronic
1186500290 X:10045359-10045381 GCCAAAGGGCCATGCTCACCTGG - Intronic
1186662476 X:11683095-11683117 GCCAAATGCCCTTCCTCCTAAGG + Intergenic
1191928714 X:66344615-66344637 GCCAAAAGGCCTCCCTCAGCAGG - Intergenic
1195710209 X:107767314-107767336 CACCATTGGCCTTCCTCTCCTGG - Intronic
1196921961 X:120594108-120594130 GCCAAATGGCCTTCCTCTCCTGG - Intronic
1198275217 X:135093503-135093525 GCCCAATTCCCTGCCTCTCCAGG + Intergenic
1199668189 X:150118888-150118910 ACCAATAGGCCTTCCTGTCCTGG + Intergenic