ID: 1196923986

View in Genome Browser
Species Human (GRCh38)
Location X:120613776-120613798
Sequence CATTATTTAAGGAGTCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196923986_1196923991 5 Left 1196923986 X:120613776-120613798 CCCACTAGACTCCTTAAATAATG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1196923991 X:120613804-120613826 CTTCTATAAGTGGAATATGAGGG 0: 1
1: 0
2: 0
3: 21
4: 176
1196923986_1196923989 -5 Left 1196923986 X:120613776-120613798 CCCACTAGACTCCTTAAATAATG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1196923989 X:120613794-120613816 TAATGTATATCTTCTATAAGTGG 0: 1
1: 0
2: 0
3: 25
4: 236
1196923986_1196923992 11 Left 1196923986 X:120613776-120613798 CCCACTAGACTCCTTAAATAATG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1196923992 X:120613810-120613832 TAAGTGGAATATGAGGGACATGG 0: 1
1: 0
2: 0
3: 19
4: 223
1196923986_1196923990 4 Left 1196923986 X:120613776-120613798 CCCACTAGACTCCTTAAATAATG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1196923990 X:120613803-120613825 TCTTCTATAAGTGGAATATGAGG 0: 1
1: 0
2: 0
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196923986 Original CRISPR CATTATTTAAGGAGTCTAGT GGG (reversed) Intronic
901747623 1:11384991-11385013 CATTCTTTCAGGATTCTAGGTGG - Intergenic
901913554 1:12480118-12480140 CATTATTTCAGGAGTGGAATGGG - Intronic
905858681 1:41331527-41331549 CATTATTTAAGGAGTATTTTGGG + Intergenic
909512082 1:76464705-76464727 GATAATTTAAAGATTCTAGTAGG - Intronic
911573986 1:99552442-99552464 CATTATTTAATGACTGTAATGGG + Intergenic
913484213 1:119318987-119319009 CATTACTTAGGGACTCAAGTTGG - Intergenic
918471297 1:184877672-184877694 CATTATGAAAGGACTCTATTTGG - Intronic
918674321 1:187263177-187263199 CATTATTTAAAGAGTATCTTTGG + Intergenic
921504876 1:215955695-215955717 CAGAATCTAAGGATTCTAGTGGG - Intronic
922447606 1:225710886-225710908 CCTTCTTCAAAGAGTCTAGTGGG + Intergenic
924214142 1:241802716-241802738 CATTAATTATGGAATCTAGGTGG + Intergenic
1065592810 10:27282843-27282865 CATTATTTCTGGAGGGTAGTGGG + Intergenic
1065657555 10:27967441-27967463 CATTATTTCTGGAGGGTAGTGGG - Intronic
1065752804 10:28903110-28903132 AAGTATTTAAGAAGTCTACTGGG - Intergenic
1069159727 10:65079063-65079085 AATTATTTAGGGTATCTAGTGGG + Intergenic
1071716094 10:88097149-88097171 CATTATTTTGGAGGTCTAGTTGG + Intergenic
1074118032 10:110472340-110472362 CATTATTTAAAGAGTCTCTGAGG + Intergenic
1074169980 10:110922824-110922846 CATTTCTTAATGAGACTAGTAGG + Intronic
1081206828 11:40285259-40285281 CATTATTTAAGGAGAAGATTAGG + Intronic
1081851805 11:46279099-46279121 GATTGTTTGGGGAGTCTAGTGGG + Intronic
1086676464 11:89613790-89613812 TATTATTTGAGGAGACTATTTGG + Intergenic
1090505304 11:127305707-127305729 CATTCTTTAAAAAGTCTATTAGG + Intergenic
1101136488 12:101748782-101748804 CATTAGATAAGGATTCTAGATGG + Intronic
1101641899 12:106592164-106592186 CTTTATTCTAGGTGTCTAGTTGG + Intronic
1108721989 13:53141607-53141629 CAAAACTTAAGGAGTCTAGTTGG + Intergenic
1109160491 13:58968041-58968063 CATGAAACAAGGAGTCTAGTGGG + Intergenic
1110142495 13:72148106-72148128 CATAATTTAAGGAGTCATGAAGG + Intergenic
1111654691 13:91137809-91137831 CATTAATTAAAGTGTCTAGAAGG + Intergenic
1113196484 13:107813899-107813921 CATTGTTTAACTATTCTAGTTGG + Intronic
1116300134 14:43169271-43169293 CATTATTTTAGGAGTTTAAAAGG + Intergenic
1120984826 14:90325478-90325500 CATTCAGTAAGGAGTCTGGTGGG - Intronic
1127145179 15:56016038-56016060 CACTGTTTAAGGAGTGGAGTTGG - Intergenic
1127606958 15:60596002-60596024 CATTTTTGCAGGAGTCTAGACGG + Intronic
1131867842 15:96731106-96731128 AATTATTTAGGGAGCCTAGGTGG - Intergenic
1133208951 16:4252089-4252111 CATTATTTAGGTATTCTGGTAGG - Intergenic
1133501875 16:6374179-6374201 AATTATTCAAGTAGTCTACTTGG + Intronic
1135537651 16:23306497-23306519 CATTTTATAAGGAGTATAATTGG - Intronic
1149856798 17:60089496-60089518 CATTATATAAGGTATCTTGTGGG - Intergenic
1154049548 18:10941116-10941138 AATTGTTTAGGGTGTCTAGTTGG - Intronic
1156589048 18:38465420-38465442 CATTATTTCATGAGCCTATTAGG - Intergenic
930940832 2:57012839-57012861 AACTATTTAAGCAGTCTAGGGGG - Intergenic
933603060 2:84353514-84353536 CATAATTTAAAGAGTCAAATAGG + Intergenic
936556439 2:113501875-113501897 CATTTTTACAGGAGTCTAATTGG + Intergenic
939021072 2:136959055-136959077 AATTCTTTAAGGAGTGTAATTGG + Intronic
940418740 2:153454102-153454124 CACTATTAGAGGGGTCTAGTAGG + Intergenic
941578123 2:167261500-167261522 AATAATTTAAGGAGTATAATTGG - Intergenic
942129156 2:172861179-172861201 CATTATTTAAGCAATCTTCTCGG - Intronic
942554996 2:177163002-177163024 AATTATATAAGGATTATAGTAGG + Intergenic
943689173 2:190851386-190851408 CATTTTTAAAGAAGTCTAGAAGG - Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945139390 2:206667638-206667660 AATTAATTAAGGAGTAGAGTAGG - Intronic
945506692 2:210650602-210650624 CATTCTTTTAGGAGACTAGAGGG - Intronic
946074300 2:217061351-217061373 CCTTATCTTAGGAGTCCAGTGGG + Intergenic
946285668 2:218700709-218700731 CAGTATATAAAGAGTCCAGTAGG + Intronic
946779806 2:223182381-223182403 CATTTTTGAAGGAGTCTAAATGG - Intronic
947299527 2:228673403-228673425 CATCATTTCAGAAGTCTATTTGG + Intergenic
947956249 2:234194774-234194796 CATTATTCAGGGAGTTTTGTGGG + Intergenic
1169098335 20:2923328-2923350 CTTTATTTAAGGACACTACTTGG - Intronic
1172001616 20:31782538-31782560 TATGATTTAAGGACTATAGTGGG + Intronic
1176950069 21:15034000-15034022 TTTTATTTAAAGAGTCTAGTGGG - Intronic
1177608970 21:23421196-23421218 CAATATTGATGGAGTGTAGTTGG + Intergenic
1180660288 22:17461282-17461304 CATTGTTTTAGGAGACTGGTGGG - Intronic
955443659 3:58983989-58984011 CATGATTTCAGGAGTTAAGTTGG + Intronic
958126456 3:89362607-89362629 CATTGTATAAGGAGTGTACTGGG + Intronic
958481500 3:94650814-94650836 CATAATTTCAGGTGTCTAGCAGG - Intergenic
959230455 3:103643960-103643982 CATTATCTAAGGAATTTAATTGG + Intergenic
960218823 3:115078152-115078174 CTATATTTAAGAAGTCTATTAGG - Intronic
960352056 3:116606067-116606089 CAAAATTTAAGGAGTATAATGGG - Intronic
963523314 3:146383337-146383359 TACTACTTAAGGAGCCTAGTAGG - Intergenic
971584280 4:28385371-28385393 CATTGTTTAAGGAGACCAGCTGG - Intronic
974753082 4:66166840-66166862 CATGATTTCAGGCGTCTACTGGG + Intergenic
976550562 4:86390276-86390298 TATTATTTAAAAAGTCTATTGGG + Intronic
980578060 4:134711324-134711346 CATTATTTACAGAGTCTATGTGG - Intergenic
980636839 4:135516825-135516847 CATTACTTTAGGAGAATAGTAGG - Intergenic
981617858 4:146661157-146661179 CATTTTTTGAGGAATTTAGTAGG + Intergenic
987036559 5:14024709-14024731 ACTTGTTTAAGGAATCTAGTGGG - Intergenic
988552866 5:32212376-32212398 CATTTTTAAATGAGTCTAATTGG + Intergenic
988774411 5:34464310-34464332 CACAATTTCAGGTGTCTAGTAGG + Intergenic
989503426 5:42196821-42196843 GATGATTTAAGGAGCTTAGTTGG - Intergenic
994949523 5:106441313-106441335 AATTATTTAAGGAATGAAGTGGG + Intergenic
997984842 5:138493612-138493634 CAAAATTTAAGGAGCCTTGTGGG + Intergenic
999611381 5:153373674-153373696 CAATATTTAAGGAGAGTAATGGG - Intergenic
999850498 5:155532750-155532772 CATAATTTAAGGTGAGTAGTGGG - Intergenic
1000035616 5:157445382-157445404 CAACATTTAAAGAGTCTATTTGG + Intronic
1003368443 6:5500119-5500141 CATCGTTTAAGAAGTCTATTGGG + Intronic
1005575934 6:27189088-27189110 CAGTCTTTAAGGAGCATAGTGGG - Intergenic
1006243465 6:32707846-32707868 CACCAGCTAAGGAGTCTAGTTGG - Intergenic
1014405542 6:121046272-121046294 CACAATTTCAGGTGTCTAGTAGG - Intergenic
1017880344 6:158558702-158558724 CCTTATGTAAGGACTCAAGTAGG + Intronic
1027008395 7:74719030-74719052 CATTTTTAAAGGAGACTTGTGGG + Intronic
1033289034 7:140065762-140065784 CATTATTTAACCTATCTAGTGGG + Intergenic
1037729725 8:21514352-21514374 CATAATTTCATGAGTCCAGTAGG + Intergenic
1038824911 8:30989594-30989616 CATTATTTAGGAGGTCTATTAGG + Intergenic
1042013127 8:64272675-64272697 CAATATTTAAGTAATCCAGTAGG - Intergenic
1042484412 8:69334810-69334832 AATAACTTAAGGAGTGTAGTTGG + Intergenic
1043095737 8:75969404-75969426 CATTATTTATGTAGTATAATTGG - Intergenic
1045613803 8:103881567-103881589 TAGAATTTAAGGAGTCTAATTGG + Intronic
1049896582 9:115464-115486 CATTTTTACAGGAGTCTAATTGG - Intergenic
1050732668 9:8727234-8727256 CATTTTTTATTGAGTATAGTAGG - Intronic
1054688663 9:68305620-68305642 CATTTTTACAGGAGTCTAATTGG + Intergenic
1055786708 9:79877746-79877768 CAGTGTTTAGGCAGTCTAGTAGG - Intergenic
1056073485 9:83014213-83014235 CATTTTCTAAGGAGGCTACTGGG + Intronic
1057889157 9:98855049-98855071 CATTATTGAAAGAGTTTAGTTGG + Intergenic
1059642782 9:116234042-116234064 TTTTTTTTAAGGTGTCTAGTTGG + Intronic
1188176289 X:26994783-26994805 TACTATTTCAGGAGTCTATTTGG + Intergenic
1189714580 X:43852523-43852545 CATTAATTGTGGAGTCTAGTTGG + Intronic
1194224005 X:91232091-91232113 AATAATTTAAAGAGTATAGTTGG + Intergenic
1196923986 X:120613776-120613798 CATTATTTAAGGAGTCTAGTGGG - Intronic
1199168596 X:144707966-144707988 CATTATCTATGAAGTGTAGTTGG - Intergenic
1199296356 X:146163187-146163209 CATTAGTCAAGGATTCTAATGGG + Intergenic