ID: 1196931420

View in Genome Browser
Species Human (GRCh38)
Location X:120685264-120685286
Sequence TGTGGATCTGAGAAGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931420_1196931425 -9 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931425 X:120685278-120685300 AGATCCACACCTCTGGAGCGGGG No data
1196931420_1196931428 0 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931428 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
1196931420_1196931424 -10 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931424 X:120685277-120685299 CAGATCCACACCTCTGGAGCGGG No data
1196931420_1196931429 9 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931429 X:120685296-120685318 CGGGGCTAGTGAGGTATGACTGG No data
1196931420_1196931430 16 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931430 X:120685303-120685325 AGTGAGGTATGACTGGCCAGTGG No data
1196931420_1196931431 25 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931420 Original CRISPR TGTGGATCTGAGAAGCCTCT GGG (reversed) Intergenic