ID: 1196931421

View in Genome Browser
Species Human (GRCh38)
Location X:120685265-120685287
Sequence GTGTGGATCTGAGAAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931421_1196931430 15 Left 1196931421 X:120685265-120685287 CCAGAGGCTTCTCAGATCCACAC No data
Right 1196931430 X:120685303-120685325 AGTGAGGTATGACTGGCCAGTGG No data
1196931421_1196931428 -1 Left 1196931421 X:120685265-120685287 CCAGAGGCTTCTCAGATCCACAC No data
Right 1196931428 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
1196931421_1196931425 -10 Left 1196931421 X:120685265-120685287 CCAGAGGCTTCTCAGATCCACAC No data
Right 1196931425 X:120685278-120685300 AGATCCACACCTCTGGAGCGGGG No data
1196931421_1196931431 24 Left 1196931421 X:120685265-120685287 CCAGAGGCTTCTCAGATCCACAC No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data
1196931421_1196931429 8 Left 1196931421 X:120685265-120685287 CCAGAGGCTTCTCAGATCCACAC No data
Right 1196931429 X:120685296-120685318 CGGGGCTAGTGAGGTATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931421 Original CRISPR GTGTGGATCTGAGAAGCCTC TGG (reversed) Intergenic