ID: 1196931426

View in Genome Browser
Species Human (GRCh38)
Location X:120685282-120685304
Sequence CTAGCCCCGCTCCAGAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931426_1196931431 7 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data
1196931426_1196931429 -9 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931429 X:120685296-120685318 CGGGGCTAGTGAGGTATGACTGG No data
1196931426_1196931435 27 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931435 X:120685332-120685354 AGGCCTGCATTACTGAGGGATGG No data
1196931426_1196931437 29 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931437 X:120685334-120685356 GCCTGCATTACTGAGGGATGGGG No data
1196931426_1196931430 -2 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931430 X:120685303-120685325 AGTGAGGTATGACTGGCCAGTGG No data
1196931426_1196931434 23 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931434 X:120685328-120685350 TGATAGGCCTGCATTACTGAGGG No data
1196931426_1196931433 22 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931433 X:120685327-120685349 GTGATAGGCCTGCATTACTGAGG No data
1196931426_1196931439 30 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931439 X:120685335-120685357 CCTGCATTACTGAGGGATGGGGG No data
1196931426_1196931436 28 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931436 X:120685333-120685355 GGCCTGCATTACTGAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931426 Original CRISPR CTAGCCCCGCTCCAGAGGTG TGG (reversed) Intergenic