ID: 1196931427

View in Genome Browser
Species Human (GRCh38)
Location X:120685287-120685309
Sequence CCTCACTAGCCCCGCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931427_1196931436 23 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931436 X:120685333-120685355 GGCCTGCATTACTGAGGGATGGG No data
1196931427_1196931433 17 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931433 X:120685327-120685349 GTGATAGGCCTGCATTACTGAGG No data
1196931427_1196931431 2 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data
1196931427_1196931437 24 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931437 X:120685334-120685356 GCCTGCATTACTGAGGGATGGGG No data
1196931427_1196931434 18 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931434 X:120685328-120685350 TGATAGGCCTGCATTACTGAGGG No data
1196931427_1196931430 -7 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931430 X:120685303-120685325 AGTGAGGTATGACTGGCCAGTGG No data
1196931427_1196931435 22 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931435 X:120685332-120685354 AGGCCTGCATTACTGAGGGATGG No data
1196931427_1196931439 25 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931439 X:120685335-120685357 CCTGCATTACTGAGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931427 Original CRISPR CCTCACTAGCCCCGCTCCAG AGG (reversed) Intergenic