ID: 1196931429 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:120685296-120685318 |
| Sequence | CGGGGCTAGTGAGGTATGAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196931421_1196931429 | 8 | Left | 1196931421 | X:120685265-120685287 | CCAGAGGCTTCTCAGATCCACAC | No data | ||
| Right | 1196931429 | X:120685296-120685318 | CGGGGCTAGTGAGGTATGACTGG | No data | ||||
| 1196931420_1196931429 | 9 | Left | 1196931420 | X:120685264-120685286 | CCCAGAGGCTTCTCAGATCCACA | No data | ||
| Right | 1196931429 | X:120685296-120685318 | CGGGGCTAGTGAGGTATGACTGG | No data | ||||
| 1196931426_1196931429 | -9 | Left | 1196931426 | X:120685282-120685304 | CCACACCTCTGGAGCGGGGCTAG | 0: 1 1: 0 2: 0 3: 10 4: 127 |
||
| Right | 1196931429 | X:120685296-120685318 | CGGGGCTAGTGAGGTATGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196931429 | Original CRISPR | CGGGGCTAGTGAGGTATGAC TGG | Intergenic | ||