ID: 1196931429 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:120685296-120685318 |
Sequence | CGGGGCTAGTGAGGTATGAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1196931421_1196931429 | 8 | Left | 1196931421 | X:120685265-120685287 | CCAGAGGCTTCTCAGATCCACAC | No data | ||
Right | 1196931429 | X:120685296-120685318 | CGGGGCTAGTGAGGTATGACTGG | No data | ||||
1196931420_1196931429 | 9 | Left | 1196931420 | X:120685264-120685286 | CCCAGAGGCTTCTCAGATCCACA | No data | ||
Right | 1196931429 | X:120685296-120685318 | CGGGGCTAGTGAGGTATGACTGG | No data | ||||
1196931426_1196931429 | -9 | Left | 1196931426 | X:120685282-120685304 | CCACACCTCTGGAGCGGGGCTAG | 0: 1 1: 0 2: 0 3: 10 4: 127 |
||
Right | 1196931429 | X:120685296-120685318 | CGGGGCTAGTGAGGTATGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1196931429 | Original CRISPR | CGGGGCTAGTGAGGTATGAC TGG | Intergenic | ||