ID: 1196931431

View in Genome Browser
Species Human (GRCh38)
Location X:120685312-120685334
Sequence TGACTGGCCAGTGGAGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931427_1196931431 2 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data
1196931421_1196931431 24 Left 1196931421 X:120685265-120685287 CCAGAGGCTTCTCAGATCCACAC No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data
1196931420_1196931431 25 Left 1196931420 X:120685264-120685286 CCCAGAGGCTTCTCAGATCCACA No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data
1196931426_1196931431 7 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931431 X:120685312-120685334 TGACTGGCCAGTGGAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931431 Original CRISPR TGACTGGCCAGTGGAGTGAT AGG Intergenic