ID: 1196931432

View in Genome Browser
Species Human (GRCh38)
Location X:120685319-120685341
Sequence ATGCAGGCCTATCACTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931432_1196931439 -7 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931439 X:120685335-120685357 CCTGCATTACTGAGGGATGGGGG No data
1196931432_1196931442 5 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931442 X:120685347-120685369 AGGGATGGGGGTTTCAGGGAAGG No data
1196931432_1196931436 -9 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931436 X:120685333-120685355 GGCCTGCATTACTGAGGGATGGG No data
1196931432_1196931441 1 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931441 X:120685343-120685365 ACTGAGGGATGGGGGTTTCAGGG No data
1196931432_1196931437 -8 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931437 X:120685334-120685356 GCCTGCATTACTGAGGGATGGGG No data
1196931432_1196931440 0 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931440 X:120685342-120685364 TACTGAGGGATGGGGGTTTCAGG No data
1196931432_1196931435 -10 Left 1196931432 X:120685319-120685341 CCAGTGGAGTGATAGGCCTGCAT No data
Right 1196931435 X:120685332-120685354 AGGCCTGCATTACTGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931432 Original CRISPR ATGCAGGCCTATCACTCCAC TGG (reversed) Intergenic