ID: 1196931433 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:120685327-120685349 |
| Sequence | GTGATAGGCCTGCATTACTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196931426_1196931433 | 22 | Left | 1196931426 | X:120685282-120685304 | CCACACCTCTGGAGCGGGGCTAG | 0: 1 1: 0 2: 0 3: 10 4: 127 |
||
| Right | 1196931433 | X:120685327-120685349 | GTGATAGGCCTGCATTACTGAGG | No data | ||||
| 1196931427_1196931433 | 17 | Left | 1196931427 | X:120685287-120685309 | CCTCTGGAGCGGGGCTAGTGAGG | No data | ||
| Right | 1196931433 | X:120685327-120685349 | GTGATAGGCCTGCATTACTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196931433 | Original CRISPR | GTGATAGGCCTGCATTACTG AGG | Intergenic | ||