ID: 1196931433

View in Genome Browser
Species Human (GRCh38)
Location X:120685327-120685349
Sequence GTGATAGGCCTGCATTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931426_1196931433 22 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931433 X:120685327-120685349 GTGATAGGCCTGCATTACTGAGG No data
1196931427_1196931433 17 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931433 X:120685327-120685349 GTGATAGGCCTGCATTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931433 Original CRISPR GTGATAGGCCTGCATTACTG AGG Intergenic