ID: 1196931434

View in Genome Browser
Species Human (GRCh38)
Location X:120685328-120685350
Sequence TGATAGGCCTGCATTACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196931426_1196931434 23 Left 1196931426 X:120685282-120685304 CCACACCTCTGGAGCGGGGCTAG No data
Right 1196931434 X:120685328-120685350 TGATAGGCCTGCATTACTGAGGG No data
1196931427_1196931434 18 Left 1196931427 X:120685287-120685309 CCTCTGGAGCGGGGCTAGTGAGG No data
Right 1196931434 X:120685328-120685350 TGATAGGCCTGCATTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196931434 Original CRISPR TGATAGGCCTGCATTACTGA GGG Intergenic