ID: 1196931442 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:120685347-120685369 |
| Sequence | AGGGATGGGGGTTTCAGGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196931432_1196931442 | 5 | Left | 1196931432 | X:120685319-120685341 | CCAGTGGAGTGATAGGCCTGCAT | No data | ||
| Right | 1196931442 | X:120685347-120685369 | AGGGATGGGGGTTTCAGGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196931442 | Original CRISPR | AGGGATGGGGGTTTCAGGGA AGG | Intergenic | ||