ID: 1196933322

View in Genome Browser
Species Human (GRCh38)
Location X:120703886-120703908
Sequence TTACCTCAGTCAGATATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196933319_1196933322 14 Left 1196933319 X:120703849-120703871 CCAAGCAAATATACCTCTAGTTG No data
Right 1196933322 X:120703886-120703908 TTACCTCAGTCAGATATCTCTGG No data
1196933321_1196933322 1 Left 1196933321 X:120703862-120703884 CCTCTAGTTGTGCTTAGGAATTT No data
Right 1196933322 X:120703886-120703908 TTACCTCAGTCAGATATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196933322 Original CRISPR TTACCTCAGTCAGATATCTC TGG Intergenic
No off target data available for this crispr