ID: 1196934929

View in Genome Browser
Species Human (GRCh38)
Location X:120720060-120720082
Sequence GAGTATCCCTGACACCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196934925_1196934929 0 Left 1196934925 X:120720037-120720059 CCTGTAATTACTGTAGGAAGTGG No data
Right 1196934929 X:120720060-120720082 GAGTATCCCTGACACCTTGGTGG No data
1196934923_1196934929 27 Left 1196934923 X:120720010-120720032 CCAGGAATCTGAGTCAGGAAGAA No data
Right 1196934929 X:120720060-120720082 GAGTATCCCTGACACCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196934929 Original CRISPR GAGTATCCCTGACACCTTGG TGG Intergenic
No off target data available for this crispr