ID: 1196936698

View in Genome Browser
Species Human (GRCh38)
Location X:120737477-120737499
Sequence CTAAATCATATGTAGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196936698_1196936700 -3 Left 1196936698 X:120737477-120737499 CCTTTCATCTACATATGATTTAG No data
Right 1196936700 X:120737497-120737519 TAGTGCCTCAGCCACTGCTAGGG No data
1196936698_1196936703 15 Left 1196936698 X:120737477-120737499 CCTTTCATCTACATATGATTTAG No data
Right 1196936703 X:120737515-120737537 TAGGGTACCTTTCTGTAAACTGG No data
1196936698_1196936699 -4 Left 1196936698 X:120737477-120737499 CCTTTCATCTACATATGATTTAG No data
Right 1196936699 X:120737496-120737518 TTAGTGCCTCAGCCACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196936698 Original CRISPR CTAAATCATATGTAGATGAA AGG (reversed) Intergenic
No off target data available for this crispr