ID: 1196937141

View in Genome Browser
Species Human (GRCh38)
Location X:120741210-120741232
Sequence ACTAATGGGAGACACAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196937141_1196937145 -1 Left 1196937141 X:120741210-120741232 CCTTGTCTGTGTCTCCCATTAGT No data
Right 1196937145 X:120741232-120741254 TCCCTCAGCTCTACAAGTTTGGG No data
1196937141_1196937144 -2 Left 1196937141 X:120741210-120741232 CCTTGTCTGTGTCTCCCATTAGT No data
Right 1196937144 X:120741231-120741253 GTCCCTCAGCTCTACAAGTTTGG No data
1196937141_1196937147 0 Left 1196937141 X:120741210-120741232 CCTTGTCTGTGTCTCCCATTAGT No data
Right 1196937147 X:120741233-120741255 CCCTCAGCTCTACAAGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196937141 Original CRISPR ACTAATGGGAGACACAGACA AGG (reversed) Intergenic
No off target data available for this crispr