ID: 1196937144

View in Genome Browser
Species Human (GRCh38)
Location X:120741231-120741253
Sequence GTCCCTCAGCTCTACAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196937141_1196937144 -2 Left 1196937141 X:120741210-120741232 CCTTGTCTGTGTCTCCCATTAGT No data
Right 1196937144 X:120741231-120741253 GTCCCTCAGCTCTACAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196937144 Original CRISPR GTCCCTCAGCTCTACAAGTT TGG Intergenic
No off target data available for this crispr