ID: 1196937559

View in Genome Browser
Species Human (GRCh38)
Location X:120744791-120744813
Sequence TGATACTGGATTTCAGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196937559_1196937561 -9 Left 1196937559 X:120744791-120744813 CCATAAACTGAAATCCAGTATCA No data
Right 1196937561 X:120744805-120744827 CCAGTATCAAGTACCCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196937559 Original CRISPR TGATACTGGATTTCAGTTTA TGG (reversed) Intergenic
No off target data available for this crispr