ID: 1196939193

View in Genome Browser
Species Human (GRCh38)
Location X:120759246-120759268
Sequence CAGGGCAATCACTCTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196939193_1196939196 20 Left 1196939193 X:120759246-120759268 CCATTCACAGAGTGATTGCCCTG No data
Right 1196939196 X:120759289-120759311 AAATGTGCCATAATTTTGATAGG No data
1196939193_1196939197 21 Left 1196939193 X:120759246-120759268 CCATTCACAGAGTGATTGCCCTG No data
Right 1196939197 X:120759290-120759312 AATGTGCCATAATTTTGATAGGG No data
1196939193_1196939200 27 Left 1196939193 X:120759246-120759268 CCATTCACAGAGTGATTGCCCTG No data
Right 1196939200 X:120759296-120759318 CCATAATTTTGATAGGGAGGAGG No data
1196939193_1196939198 24 Left 1196939193 X:120759246-120759268 CCATTCACAGAGTGATTGCCCTG No data
Right 1196939198 X:120759293-120759315 GTGCCATAATTTTGATAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196939193 Original CRISPR CAGGGCAATCACTCTGTGAA TGG (reversed) Intergenic
No off target data available for this crispr