ID: 1196942337

View in Genome Browser
Species Human (GRCh38)
Location X:120789351-120789373
Sequence ACATCTGGGCATTAAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196942333_1196942337 -1 Left 1196942333 X:120789329-120789351 CCCTGGTTGGGGGAGGGTGAATA No data
Right 1196942337 X:120789351-120789373 ACATCTGGGCATTAAGTAACTGG No data
1196942334_1196942337 -2 Left 1196942334 X:120789330-120789352 CCTGGTTGGGGGAGGGTGAATAC No data
Right 1196942337 X:120789351-120789373 ACATCTGGGCATTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196942337 Original CRISPR ACATCTGGGCATTAAGTAAC TGG Intergenic