ID: 1196942521

View in Genome Browser
Species Human (GRCh38)
Location X:120791381-120791403
Sequence CCACTAAGAATGCTGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196942521_1196942526 6 Left 1196942521 X:120791381-120791403 CCCTGCTGCAGCATTCTTAGTGG No data
Right 1196942526 X:120791410-120791432 GCCAAGAACTGGCCTTGTCCTGG No data
1196942521_1196942528 7 Left 1196942521 X:120791381-120791403 CCCTGCTGCAGCATTCTTAGTGG No data
Right 1196942528 X:120791411-120791433 CCAAGAACTGGCCTTGTCCTGGG No data
1196942521_1196942525 -5 Left 1196942521 X:120791381-120791403 CCCTGCTGCAGCATTCTTAGTGG No data
Right 1196942525 X:120791399-120791421 AGTGGCTGCTGGCCAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196942521 Original CRISPR CCACTAAGAATGCTGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr