ID: 1196958436

View in Genome Browser
Species Human (GRCh38)
Location X:120979522-120979544
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 12, 1: 1, 2: 1, 3: 25, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196958431_1196958436 29 Left 1196958431 X:120979470-120979492 CCTGCATCACTTCATCATTTGGG 0: 13
1: 2
2: 1
3: 7
4: 118
Right 1196958436 X:120979522-120979544 TGAAAAGCCATGAACTAAAAGGG 0: 12
1: 1
2: 1
3: 25
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900648713 1:3720669-3720691 CGAAAAGCCAGGAAGGAAAAAGG - Intronic
901766022 1:11500755-11500777 TCAAAAGCCAAGACCCAAAAGGG + Intronic
903615147 1:24647072-24647094 TTAAAAGGCCTGAACCAAAATGG + Intronic
906047366 1:42842387-42842409 CGGGAATCCATGAACTAAAATGG + Intronic
906304622 1:44709004-44709026 TTAAAAGACATGTACCAAAAAGG + Intronic
908469527 1:64430214-64430236 TGAAAAGCCTTGCTCTGAAAGGG + Intergenic
908990615 1:70083729-70083751 TGATAGGCCATTAACTGAAATGG - Intronic
909232706 1:73111577-73111599 TGAAAGGCCATGTTCAAAAATGG + Intergenic
909273300 1:73652102-73652124 GGAGTAGCCATCAACTAAAATGG - Intergenic
910061551 1:83099252-83099274 TCAAAAGAAATGAACTGAAATGG + Intergenic
910562406 1:88604984-88605006 TGAAAAGGCAAGAAAGAAAAAGG + Intergenic
911197167 1:95006376-95006398 GGAAAAGGCATGATATAAAAAGG + Intronic
911695050 1:100881512-100881534 TGAAAAACCAAAACCTAAAAGGG - Intronic
911962399 1:104322152-104322174 TGATAAGCAATGAATGAAAAAGG + Intergenic
912193039 1:107362960-107362982 GGAAAAGCCATGAAACAGAAGGG - Intronic
912464746 1:109864131-109864153 TGCAAAGCCAAGAACTCACATGG - Intergenic
912780055 1:112537904-112537926 TGAAAGGGAATGAACTAGAATGG - Intronic
914974661 1:152350301-152350323 TGAATGGCCATGAACTGATATGG + Exonic
915384663 1:155479054-155479076 TGAAAAGGCAGAAACGAAAACGG - Exonic
916105635 1:161428781-161428803 TGAAAAGCCATGACCCATCAGGG - Intergenic
916182347 1:162096756-162096778 TGAAAATGAATGAACTAATAAGG - Intronic
916345546 1:163787066-163787088 TCAAAAGCCATTAACAAATATGG - Intergenic
917258175 1:173139013-173139035 TGTAAAGCCAAGACCTACAAAGG + Intergenic
917459768 1:175219907-175219929 TGAAAAGGCCTGACCTAGAAAGG - Intergenic
917486956 1:175464139-175464161 TAGAAAGCCTTGAACTGAAAGGG + Intronic
917940355 1:179913791-179913813 TGAAAAGCTATGAAAGAAATAGG + Intronic
918514838 1:185352059-185352081 TGAAAAACTATGAAGTAACACGG - Intergenic
918852680 1:189712320-189712342 TTAAAAGCCATCAACAAAACAGG + Intergenic
919368035 1:196690362-196690384 TGAAAAACCAAAAACTAAATAGG - Intronic
921094657 1:211875893-211875915 TGAGAAGCCCTGAACTAGGATGG + Intergenic
921564093 1:216695044-216695066 GGAAAAGGCCTGAACTAAGATGG + Intronic
921838209 1:219799932-219799954 TGAAAAGAGATGACCAAAAAAGG + Intronic
922014608 1:221632719-221632741 TTAAAAGCCAAGCAATAAAAAGG - Intergenic
922954199 1:229585727-229585749 TGAAAAGGCACTAACCAAAAGGG - Intergenic
923125380 1:231029688-231029710 AGAAAAGCCAGGAATAAAAATGG - Intronic
924716304 1:246577592-246577614 TGAAAATCTGTGAACTAAATGGG - Intronic
924864512 1:247963105-247963127 TGAAAAGTCAAGGAATAAAAAGG + Intronic
1062970781 10:1646725-1646747 TGAAAACAAATGAACAAAAAGGG - Intronic
1063450989 10:6150063-6150085 AGAAAAGGCATGAACTTAAAAGG - Intronic
1064707163 10:18085126-18085148 TGAAGAGCCAGGAACTATAGTGG - Intergenic
1065671942 10:28128649-28128671 GGAATTGCCATCAACTAAAAGGG + Intronic
1065676294 10:28177977-28177999 TGAAGAGCCATGGAGAAAAATGG + Intronic
1066763803 10:38784477-38784499 TGGAATGCAATGAACTCAAATGG - Intergenic
1066763847 10:38784812-38784834 TGCAATGCCATGAAATAGAACGG - Intergenic
1067170630 10:43903376-43903398 GGAAAAGACATGAAACAAAATGG + Intergenic
1067964857 10:50899603-50899625 TGAAAAGTAATGAAGTATAAAGG + Intergenic
1068086297 10:52377197-52377219 TGGAAAGCCAAGAAATGAAAAGG - Intergenic
1068600561 10:58952233-58952255 CGAAAAGCCATGATCTTTAATGG - Intergenic
1068901086 10:62269475-62269497 ACAAAATCCATGAATTAAAATGG - Intergenic
1072427280 10:95340442-95340464 TGAAAAGCTTTGAACCCAAAAGG - Intronic
1073064965 10:100752853-100752875 TGAAAAGCCATGGAGAACAAGGG + Intronic
1073603081 10:104865707-104865729 TGAAAAGCCATTCTCCAAAAGGG + Intronic
1073913435 10:108373939-108373961 TGAAAACCTATGAGCTAAAGAGG - Intergenic
1075775991 10:124988788-124988810 TGGAAAGTCTTGAGCTAAAAGGG - Intronic
1077950905 11:6955654-6955676 AAAAATGCCATGAACTAGAAGGG - Intronic
1077957455 11:7036205-7036227 AAAAATGCCCTGAACTAAAATGG - Intronic
1078763200 11:14268550-14268572 TGAAAAGCCCTCAACAGAAATGG + Intergenic
1078798635 11:14620324-14620346 TGAAAAGCCAAGAGTTAAACTGG - Intronic
1079602473 11:22326778-22326800 TGAAAAGCTATGAAAGAGAATGG + Intergenic
1081234566 11:40631592-40631614 TGAAAAGAAATGAAGTAAGATGG - Intronic
1081658426 11:44873249-44873271 TGAAATTCCCTGAACTAACATGG - Intronic
1082661145 11:55912883-55912905 TAAAAGGCCATGAAGTCAAAAGG - Intergenic
1085361297 11:75890029-75890051 TGGAAGGCCATGAAATAGAAGGG + Intronic
1085657105 11:78325893-78325915 TAAAAAGAAATGAACAAAAATGG - Intronic
1087238284 11:95746177-95746199 TTAAAATCCATGAAGAAAAAAGG - Intergenic
1088755955 11:112885333-112885355 TGAAAAGTAGAGAACTAAAAAGG - Intergenic
1088977950 11:114832579-114832601 TGAAGGGCCATGAGCTCAAAAGG - Intergenic
1091002041 11:131917869-131917891 TGAGGAGCCAAAAACTAAAATGG + Intronic
1093121128 12:15272916-15272938 AGAAAAGCTTTGAACTAAAGGGG + Intronic
1095767334 12:45911486-45911508 AGAAAATCCATGAACTTGAAGGG - Intergenic
1095897985 12:47299995-47300017 TGAAAAGACAAGAATTCAAAGGG - Intergenic
1096414945 12:51404976-51404998 TGAAAAGGCTTGAGGTAAAAGGG + Intronic
1097756620 12:63414443-63414465 TGATAAACCACTAACTAAAATGG - Intergenic
1098280698 12:68860177-68860199 TGAAGAGTCAGGAACTAAATAGG - Intronic
1098808005 12:75045153-75045175 TGAATATGCATGAACTAAATGGG + Intronic
1099330585 12:81280186-81280208 TGTCAAGCCATTAACCAAAATGG + Intronic
1099371877 12:81843560-81843582 TGAACATGCATTAACTAAAATGG + Intergenic
1099831070 12:87843403-87843425 CAAAAACCCATGAACTTAAAGGG + Intergenic
1100040863 12:90315055-90315077 TCAAAAGCCATGAATGAAAAGGG - Intergenic
1100738417 12:97563902-97563924 TGAAAAATCATCAACTAAGAAGG + Intergenic
1101063685 12:100997506-100997528 TAAACAGACATGAAATAAAATGG + Intronic
1102269392 12:111519388-111519410 TGAAAAGCCATGTACAAGCATGG - Intronic
1103900698 12:124302410-124302432 TGGAGAGCCATGAACTATCAAGG - Intronic
1104357714 12:128102542-128102564 TGGAAAGCCAGGAGCCAAAAGGG + Intergenic
1105268021 13:18838882-18838904 TGCACATCCATGCACTAAAAAGG + Intergenic
1105668833 13:22589688-22589710 ACAAAAGCCATGAGCTACAATGG + Intergenic
1106657504 13:31761902-31761924 TGAAATACATTGAACTAAAACGG - Intronic
1106727392 13:32499955-32499977 TCAGTAGCCAAGAACTAAAATGG - Intronic
1106973971 13:35183618-35183640 TGAAAAAACATGAACTGGAATGG - Intronic
1107797072 13:44063743-44063765 TGAGAAGCCATTAAATAGAAGGG + Intergenic
1109103366 13:58215570-58215592 TGAAAAGCCAAGGACAAAGATGG + Intergenic
1109826725 13:67731055-67731077 TGAAAGGCCAGGAAATAATATGG + Intergenic
1110077875 13:71272453-71272475 TGAAAATACATGAACTAGAGTGG - Intergenic
1111164444 13:84440312-84440334 TAAAAAGCCATCAACTACTAAGG - Intergenic
1111724094 13:91982821-91982843 TGAAAAGCCAGGAACTCTAATGG - Intronic
1112352158 13:98645161-98645183 TGAAATGCCTTAAACTATAAAGG - Intergenic
1112638708 13:101247154-101247176 TGAAAAGACAGGGACTAGAATGG + Intronic
1113954962 13:114095145-114095167 TGAAAACCCAGTAAATAAAAGGG - Intronic
1114901233 14:27061776-27061798 TCAAAATACATGAATTAAAATGG - Intergenic
1115335572 14:32241612-32241634 TTAAAAGACATGGACCAAAAAGG + Intergenic
1116535865 14:46028905-46028927 TGCAAACCAATGCACTAAAACGG - Intergenic
1117696285 14:58367759-58367781 TTAAAAGCCCTAAACTCAAAAGG + Intronic
1117882631 14:60327519-60327541 TGAAATGCGATGCATTAAAATGG + Intergenic
1118580686 14:67294010-67294032 AGAAAAGCAAAGAACTAAAGTGG + Intronic
1118633886 14:67729963-67729985 TGAAAAGCCTTGAACAAAGCGGG - Intronic
1118702599 14:68448652-68448674 TGAAAATACAGGACCTAAAAAGG - Intronic
1120304636 14:82753070-82753092 TGGAAAGCTTTGAACTAACAGGG + Intergenic
1120337951 14:83182698-83182720 TGAAAAACCATGAACTTAAAGGG + Intergenic
1121022575 14:90590116-90590138 TGAAAAGCCACAAAGTGAAAAGG - Intronic
1123503774 15:20917113-20917135 TCAAAATCCATAAACTAGAAAGG - Intergenic
1123561020 15:21490785-21490807 TCAAAATCCATAAACTAGAAAGG - Intergenic
1123597262 15:21928078-21928100 TCAAAATCCATAAACTAGAAAGG - Intergenic
1123964466 15:25440829-25440851 TTAAAATTAATGAACTAAAACGG - Intergenic
1125116682 15:36101564-36101586 TGAAGAAACAAGAACTAAAATGG + Intergenic
1125317728 15:38449446-38449468 TGAAAAGGCCTGAACTGAAATGG + Intergenic
1125409655 15:39392179-39392201 TGAAAAGAAATGAGCTAAGATGG - Intergenic
1125581141 15:40786717-40786739 TGAAAAGCCATGATCTGGATGGG - Intronic
1126453749 15:48839298-48839320 CCAAAAGCCATGGACTAGAAGGG - Intronic
1127297191 15:57619126-57619148 TGAAAACCCACAAAATAAAATGG - Intronic
1127367437 15:58304655-58304677 TCAAAACTCATGGACTAAAATGG + Intronic
1129513324 15:76140602-76140624 TGAAAAGCCCTGAAATATCACGG - Intronic
1130137843 15:81196796-81196818 TGAAAAGGCTTGATCCAAAAAGG - Intronic
1130377412 15:83341386-83341408 TGAAAAGCACAGAGCTAAAAGGG + Intergenic
1130396389 15:83506121-83506143 TCAAAAGTCAGGAACTATAATGG - Intronic
1202969366 15_KI270727v1_random:217951-217973 TCAAAATCCATAAACTAGAAAGG - Intergenic
1133628225 16:7592293-7592315 GGAAGGGGCATGAACTAAAAAGG - Intronic
1136674415 16:31889500-31889522 TGAACAACCATGAAATCAAAAGG - Intronic
1137308843 16:47233045-47233067 ATAAAAGCCATGAAGTAAAATGG + Intronic
1137894050 16:52191903-52191925 TGAAAAGGCAGGAAGAAAAAAGG - Intergenic
1139345615 16:66301265-66301287 TTAAAAGAAATGAACCAAAATGG + Intergenic
1140711698 16:77684724-77684746 TGAGAATCCTTGACCTAAAAAGG - Intergenic
1140823433 16:78684075-78684097 TGCACGGCCATGAGCTAAAAAGG - Intronic
1140973364 16:80035381-80035403 TGACAAGCCATGTAGCAAAAGGG - Intergenic
1141056110 16:80816069-80816091 TAAAAAACCATGAAATAGAATGG - Intergenic
1142715434 17:1744767-1744789 TGAAACACCAGAAACTAAAAAGG + Intronic
1142732807 17:1873112-1873134 TTAAAAGGCAAGAACTTAAAAGG - Intronic
1142821660 17:2473455-2473477 TGAAATGCGTTAAACTAAAAAGG + Intronic
1145329074 17:21855768-21855790 TGGAATGGAATGAACTAAAATGG + Intergenic
1145331540 17:21876560-21876582 TGAAATGGAATGAACTCAAATGG + Intergenic
1146532021 17:33616002-33616024 TCAAAGGCCATGATTTAAAATGG - Intronic
1148962751 17:51407101-51407123 TGATGAGGCATGAACTAGAATGG - Intergenic
1149160702 17:53688829-53688851 TGAAAAGCTCTCAATTAAAATGG - Intergenic
1149521994 17:57324443-57324465 TGAAAAGCCAAGGGCTACAAGGG - Intronic
1149731759 17:58953024-58953046 TGAAAACCTATGAGCTAAAAAGG + Intronic
1150180038 17:63109148-63109170 TGAAAATAAATGAACTAATAAGG + Intronic
1151022238 17:70630825-70630847 TCAAAATCTATGAACTAAAAGGG + Intergenic
1153453081 18:5251160-5251182 TGAAAGGCGATGAAGAAAAATGG - Intergenic
1153599448 18:6764856-6764878 TGTAAAGTAATGAAATAAAATGG - Intronic
1154420000 18:14221161-14221183 TGCACATCCATGCACTAAAAAGG - Intergenic
1154510587 18:15096932-15096954 TGAAGGGCCATTAACTAAGATGG + Intergenic
1156206442 18:34890922-34890944 TTAACAGCCAAGAACTAATAAGG - Exonic
1156571605 18:38260869-38260891 GGAAAAGATATGAACTAGAAAGG - Intergenic
1157321763 18:46640093-46640115 TGAATAGCCAGGACCTCAAAGGG - Intronic
1158258234 18:55577933-55577955 TGACAGGCCATGAAGTAAAAAGG + Intronic
1158291483 18:55949843-55949865 TGCAAAGCCAAGAACAAACAGGG + Intergenic
1158782250 18:60665039-60665061 TGGAAAGTCTTGAGCTAAAAGGG + Intergenic
1159464406 18:68762598-68762620 AGAAAAGCCAGAAAGTAAAAAGG + Intronic
1159674659 18:71266564-71266586 TGAACAGACAAGAACTTAAAAGG + Intergenic
1164445284 19:28312371-28312393 TGAAAATCCAGGATCAAAAACGG + Intergenic
1166945718 19:46394926-46394948 GGAACACCCATGTACTAAAAAGG - Intergenic
926778303 2:16444010-16444032 TGTAAAGCCATCCCCTAAAATGG + Intergenic
926796363 2:16622355-16622377 TGAAGAGCTCTGAAATAAAAAGG + Intronic
928049921 2:27980711-27980733 GGAAAAGATATGTACTAAAAGGG - Intronic
928111454 2:28513072-28513094 TGAAAAGCAGTGGACTAATATGG - Intronic
929090266 2:38209679-38209701 TGAAAAAACAGGAAATAAAAAGG + Intergenic
929288838 2:40166072-40166094 TAAAAAGACATGCAATAAAAGGG + Intronic
929318472 2:40510242-40510264 TAAGAAGTCATGAAATAAAAGGG + Intronic
929680973 2:43993469-43993491 TGAAAAGTGATGAAATTAAAGGG + Intronic
929726576 2:44435813-44435835 TGGTAAACTATGAACTAAAAAGG - Intronic
929949758 2:46398314-46398336 TGAAAAGACAAGCAATAAAAGGG + Intergenic
930270411 2:49250034-49250056 TGAAAAGCAGTGAAGAAAAAGGG - Intergenic
931094941 2:58928965-58928987 TGAAAAGCATTAAAATAAAAAGG + Intergenic
931589010 2:63860475-63860497 TGAAAATACATACACTAAAATGG - Intronic
931903506 2:66818462-66818484 TGAAAAGCTCTGAACCACAATGG - Intergenic
931972025 2:67599146-67599168 TGAAAAGTCATGTGTTAAAAAGG - Intergenic
933825143 2:86152896-86152918 TGAAAAGCAAAAAACAAAAAGGG + Intronic
934018898 2:87922751-87922773 TGGAAAGACATGATCTCAAAGGG + Intergenic
934031646 2:88054365-88054387 TTAAAAGGCATTTACTAAAAAGG + Intronic
937551391 2:123096516-123096538 TGAAAAGGCATGCAGAAAAAAGG - Intergenic
937868259 2:126769862-126769884 AGAAAATCCATGTACTAAAAAGG - Intergenic
938337375 2:130511671-130511693 TGAGGAGCCATGAACTGAAACGG - Intergenic
938352463 2:130609064-130609086 TGAGGAGCCATGAACTGAAACGG + Intergenic
938505804 2:131881379-131881401 TGAAGGGCCATTAACTAAGATGG + Intergenic
939200343 2:139025733-139025755 TAAAAATCCATGAAATTAAATGG - Intergenic
940812876 2:158265654-158265676 TGAAAAGGAAAGAACCAAAAAGG - Intronic
941249018 2:163138517-163138539 TAAAAAGGCATGAAGCAAAAAGG + Intergenic
941562501 2:167065449-167065471 TGAAAAGCCATCACCTAGAATGG - Intronic
941657683 2:168161567-168161589 CAAAAAGCTATGTACTAAAATGG + Intronic
941843693 2:170113201-170113223 TGAAAAAGCATTAAATAAAATGG + Intergenic
942349647 2:175039165-175039187 TGGAATTCCATGAAATAAAACGG + Intergenic
942984300 2:182121009-182121031 TGAAAAGCCATTATCTCAACTGG - Intronic
943505212 2:188747057-188747079 TGAAAGGGCATGAGTTAAAAGGG - Intronic
943570313 2:189566106-189566128 TGAAAAGTAATGAAGCAAAAGGG + Intronic
944413105 2:199460943-199460965 AGAAAAGCAATGAATTTAAAAGG - Intronic
944823876 2:203460369-203460391 TTAAATGCCAAGAACTAAATAGG - Intronic
945458425 2:210075758-210075780 TGAAATGCCATGAAATAATTAGG + Intronic
946073145 2:217051578-217051600 GGAAAAGCCAAGAAATAAACAGG - Intergenic
946589694 2:221231433-221231455 TGAAAAGTCATGATCAAAACAGG - Intergenic
946639191 2:221764943-221764965 TGAAAATATATGAAATAAAATGG - Intergenic
946673241 2:222128912-222128934 TGAAAAGCTTTGATCAAAAATGG + Intergenic
948093721 2:235316806-235316828 TGAAAATCCTTCTACTAAAAAGG + Intergenic
1168817396 20:748989-749011 TGTAAAGACCTGCACTAAAAAGG + Intergenic
1169544730 20:6638726-6638748 TGAAAAGGAATAAATTAAAATGG - Intergenic
1169652349 20:7883428-7883450 TCAAAAGCAATGAAATAAAAGGG + Exonic
1169688477 20:8303929-8303951 CAATAAGCCATGAATTAAAATGG + Intronic
1170659418 20:18322410-18322432 TGAAAACACGTGAACTACAACGG - Intergenic
1170740319 20:19050254-19050276 TCAAAAGGCATGCACTAGAATGG + Intergenic
1170999963 20:21404477-21404499 TGAAAAAACATCAACTAAACAGG + Intergenic
1171369611 20:24653046-24653068 TGGAAAGACATTAAGTAAAAAGG + Intronic
1171920720 20:31096440-31096462 TGGAAAGCAATGAAATGAAATGG + Intergenic
1171929220 20:31214600-31214622 TGGAAAGCAATGAAATGAAATGG + Intergenic
1172332898 20:34088071-34088093 TGAAAACCCATGAAAAATAATGG - Intronic
1173002767 20:39116646-39116668 TGAAAAGGCATGAACTGCAGGGG - Intergenic
1173708079 20:45128583-45128605 TGGAAAGCCTTGAACCAAAATGG + Intergenic
1176528274 21:7938122-7938144 TCAAAAGGAATGAACTCAAAAGG - Intergenic
1176787282 21:13272478-13272500 TGAATGGCCATTAACTAAGATGG - Intergenic
1176980969 21:15380766-15380788 TGAAAACCCATGACCCTAAATGG + Intergenic
1178133015 21:29594665-29594687 TAAAAAGCGATGCAATAAAAAGG + Intronic
1178630707 21:34258830-34258852 TTAAAAGACATGAAATAATACGG + Intergenic
1181448210 22:22995893-22995915 TGAAAAGCTAGTAACTAAAATGG + Intergenic
1182403864 22:30106996-30107018 TGAAAACCACTGATCTAAAATGG + Intronic
1182998255 22:34834277-34834299 TGGAAAGCCAAGAACAATAAAGG + Intergenic
1184199385 22:42955679-42955701 TGTAAAGCCATGAAGGAAAGTGG - Intronic
950293212 3:11804761-11804783 TGCAAAGCCATGCACCCAAATGG + Intronic
950473164 3:13199026-13199048 TGAAAACCCATGCACATAAAGGG + Intergenic
951032609 3:17899289-17899311 TGAAAATCAATGAATTATAAAGG - Intronic
951505324 3:23438475-23438497 TGAAAAGGTTTGAATTAAAAGGG + Intronic
951635663 3:24772968-24772990 TTAGAAGCCATGAACTAATTTGG + Intergenic
951840877 3:27032596-27032618 TTAAAAGGTATGAAGTAAAATGG - Intergenic
952982084 3:38744818-38744840 TGAAAACACATGAACATAAATGG - Intronic
953252718 3:41261186-41261208 TAAAAAGCCTTGGAGTAAAACGG + Intronic
953291189 3:41665062-41665084 GGAATAGCCAACAACTAAAAAGG + Intronic
953330670 3:42050489-42050511 GGAAAAGCGATGAACTCTAAGGG - Intronic
954760024 3:52867284-52867306 TGGAAAGTCATAAGCTAAAATGG - Intronic
955284673 3:57628036-57628058 TAAAAAGTAATGCACTAAAAAGG + Exonic
955514447 3:59712902-59712924 GGAAAAGCCATCAAATAAAATGG + Intergenic
955907345 3:63820954-63820976 GGAAAATCCATTAACTTAAAAGG - Intronic
955940323 3:64140951-64140973 TGCAAAGCCATGCACTTAACTGG - Intronic
956485485 3:69717951-69717973 TCAACTGCCATGAACTAAAATGG + Intergenic
956534209 3:70257328-70257350 TTAAAACCCATGATCCAAAAAGG - Intergenic
956765834 3:72483701-72483723 TGAAAAGCAATGAACATAAATGG - Intergenic
956998913 3:74861596-74861618 TGAAAGGCCAAGCATTAAAATGG - Intergenic
957195325 3:77060261-77060283 TGAAATGCCATGAGCTGGAATGG - Intronic
957296344 3:78337613-78337635 TGAAAGGCCATGAACTCTATGGG - Intergenic
957564734 3:81869800-81869822 AGAAATGCCTTGAAGTAAAAAGG + Intergenic
958074977 3:88664981-88665003 AGGAAATCTATGAACTAAAATGG - Intergenic
958506223 3:94980846-94980868 TGAAAAGGCATGAAATAGACTGG + Intergenic
961054106 3:123773183-123773205 TGAGAAAGCATTAACTAAAAAGG + Intronic
962300424 3:134236845-134236867 TGGACAGCCACGAACTAAAGAGG + Intronic
963308448 3:143680456-143680478 TGAAAAGTCATGCTCTAGAATGG - Intronic
963577670 3:147082032-147082054 TGTAAAACTATGAAATAAAATGG - Intergenic
965294718 3:166929311-166929333 TGCAAAGCCAAGATCTAAAGTGG - Intergenic
966296411 3:178428757-178428779 GGAAATACCATGAAATAAAATGG - Intronic
966343845 3:178956333-178956355 TGAAAATCAAAGAAATAAAAAGG - Intergenic
967668162 3:192199704-192199726 TGAAAAGGCAAAAAATAAAAAGG + Intronic
968933157 4:3594825-3594847 TGAAACGCCCTGAAACAAAATGG - Intergenic
969034663 4:4243564-4243586 TGAACAGCCATGAAATGAGAGGG - Intronic
969580177 4:8060237-8060259 TGAGAAGCTATGAGCTAAAAAGG + Intronic
970066770 4:12103955-12103977 TGATAAACCGTGAACTAAACAGG - Intergenic
970097687 4:12483009-12483031 TGAAAAACCTAGAACAAAAATGG - Intergenic
970557571 4:17250058-17250080 TGAAAATCAGTGTACTAAAATGG + Intergenic
971341708 4:25775360-25775382 TGTGCAGCCATGGACTAAAAGGG + Intronic
971910444 4:32789173-32789195 TGAAAAGCATTGAAATGAAAAGG + Intergenic
972695204 4:41438647-41438669 TGAAAAGCTCTGTAATAAAAAGG - Intronic
973031662 4:45349652-45349674 TTAAAAGCCATGCACTGAATTGG + Intergenic
973401616 4:49641324-49641346 TGGAAAGCCATGGAATGAAATGG + Intergenic
973948097 4:55981195-55981217 TGAAAAGATATAAATTAAAAAGG - Intronic
974133365 4:57784403-57784425 TGAAAAGGCATGCTATAAAAGGG - Intergenic
974574218 4:63696989-63697011 TAAAAAGCAATTAACCAAAATGG + Intergenic
975470945 4:74766943-74766965 TGTAAAGCCCTTAACTAACATGG + Intronic
975501040 4:75085186-75085208 TGAAAAGCCATGTATGTAAATGG - Intergenic
976020008 4:80611119-80611141 TGAAAGGCCATGACTTTAAAAGG - Intronic
976502391 4:85806638-85806660 TGAAAAAACATGCACAAAAATGG + Intronic
977797747 4:101188236-101188258 AGAAAAGCAGTGAAATAAAATGG + Intronic
978079875 4:104579143-104579165 TGGAAACCTATAAACTAAAATGG + Intergenic
978181005 4:105795826-105795848 TGAAAAGCCATCATCGACAAGGG - Intronic
978612546 4:110559550-110559572 TTAAAAACTATGAAATAAAAAGG + Intronic
978937380 4:114394679-114394701 AAAAAAGCCAGGAAATAAAATGG + Intergenic
979202518 4:117995432-117995454 TCACAAGCCATGAAAGAAAATGG + Intergenic
979770582 4:124520387-124520409 TGAAAAGCTATGAGAGAAAAGGG - Intergenic
980325275 4:131336742-131336764 TGTATAGCTATGAACTAAATCGG + Intergenic
980668240 4:135968450-135968472 TGAAATGCCAAAAACTAAATAGG + Intergenic
981057728 4:140382968-140382990 TTGAAAGCCATGATTTAAAATGG - Exonic
981433781 4:144694855-144694877 TGAAAACAAATGAAATAAAATGG - Intronic
981919160 4:150068089-150068111 TGAAAACACATGTACTCAAAGGG + Intergenic
984368773 4:178833280-178833302 TGTCAAGCCATGAACAAACATGG - Intergenic
986755184 5:10829085-10829107 TGAAAAGCCATAAAAAAGAATGG - Intergenic
987057735 5:14210644-14210666 GGAAAAACCATGAAAGAAAAAGG + Intronic
987193743 5:15504312-15504334 TGGAAAGACATTAACTAACAGGG + Intronic
987350026 5:17013695-17013717 TGAAAACCAATTAAATAAAAGGG - Intergenic
987977059 5:25028183-25028205 TCAAAAGCCATGAAAAATAAAGG - Intergenic
988363555 5:30266817-30266839 TGAATATCCATGAAATAAGAAGG - Intergenic
989280510 5:39637113-39637135 AGCAAACCCATCAACTAAAAGGG - Intergenic
990963946 5:61424520-61424542 TTAGAAGCAGTGAACTAAAATGG - Intronic
992510777 5:77432494-77432516 TGAAGAGCCATGGGCTAAATGGG - Exonic
993197420 5:84765836-84765858 TAAAAATCTATGAAATAAAAAGG - Intergenic
993346007 5:86783433-86783455 AGAAAAGCCAAGATATAAAAGGG + Intergenic
994366841 5:98927739-98927761 TGAAAAGGAAAGAACGAAAAGGG - Intronic
994618795 5:102138176-102138198 AGAAAAGCCAGAAAATAAAAGGG - Intergenic
994727320 5:103451989-103452011 TGAAAATCCATATACTAAAGAGG + Intergenic
995886170 5:116896339-116896361 TGACAAGCCATGAAAAAACAGGG - Intergenic
996090187 5:119343064-119343086 GGAAATGCCATCAACTGAAATGG + Intronic
997536430 5:134625869-134625891 TGAAAAGCCTTGACAGAAAAAGG + Intronic
998902740 5:146873416-146873438 TGGAAAGCCATTAAGGAAAAGGG - Intronic
999888726 5:155953185-155953207 TAAAAAGGCAGGAAGTAAAAAGG - Intronic
999898180 5:156057620-156057642 AGAAAATGCATGAACTGAAAGGG + Intronic
999970693 5:156859216-156859238 TTAAAAATCATGAACAAAAATGG - Intergenic
1000208847 5:159091612-159091634 TGAAGAACCATGAACTGAAAGGG + Intronic
1000695395 5:164374927-164374949 TGCAAAGCCATGAAATAAGATGG + Intergenic
1000751743 5:165103590-165103612 TGAGAAGGCATGTATTAAAAAGG - Intergenic
1004548512 6:16623695-16623717 AAAAATGCCATGAACTAAATGGG - Intronic
1005676204 6:28157962-28157984 TGAAAAACCATGAACAATAGAGG - Exonic
1005831975 6:29678498-29678520 AGAGAAGCCATAAAATAAAAAGG + Intronic
1006770744 6:36550492-36550514 TGAAAAACCTTGCATTAAAATGG + Intergenic
1007064861 6:38979975-38979997 AGAAATTCCAAGAACTAAAACGG + Intronic
1009581815 6:65545718-65545740 TTAAAAGCAATGAACAAACATGG + Intronic
1011810413 6:91126116-91126138 TGCAAATCCCTGAAATAAAATGG - Intergenic
1012117166 6:95316332-95316354 TGAAATATCATGAAATAAAATGG - Intergenic
1012360633 6:98374184-98374206 GGAAAAGAAATGAAATAAAATGG + Intergenic
1014152796 6:118078057-118078079 TGAGAAGCCATTAAAAAAAAAGG - Intronic
1014474566 6:121856525-121856547 TGAAATGTCAAGAACTCAAAAGG + Intergenic
1015018322 6:128441324-128441346 TGAAAAAACATGAAGTGAAATGG + Intronic
1016148894 6:140711401-140711423 TTGAAAGCAATGAAGTAAAACGG - Intergenic
1016217063 6:141617351-141617373 TGAAAAGACAAGTAATAAAATGG + Intergenic
1016869776 6:148805473-148805495 AGAAAAGGCATGACATAAAAAGG + Intronic
1018601344 6:165546095-165546117 TAACAAGCCATGAAGTAACATGG + Intronic
1019131214 6:169877447-169877469 TGAAAACCATTTAACTAAAAAGG - Intergenic
1022263707 7:28732543-28732565 AGAAAAGCCAGGAAAAAAAAAGG + Intronic
1023517142 7:41012322-41012344 TGAAGAGCCGTGAACTATAATGG + Intergenic
1026464824 7:70644985-70645007 GGAAAGGCCATGGCCTAAAATGG + Intronic
1027414605 7:77961916-77961938 AGCAAAGCCATAAAGTAAAAAGG + Intergenic
1028222061 7:88209458-88209480 AGAAAAGCCATCCAGTAAAAAGG + Intronic
1029045756 7:97626393-97626415 GAAATAGCCATGAACAAAAATGG - Intergenic
1029844000 7:103394421-103394443 TGCACAGGCATGAACTAAGAGGG + Intronic
1030381446 7:108815989-108816011 TGAAAAGCAATGATCTAATCAGG - Intergenic
1030753832 7:113264911-113264933 TTAAGAGCAATGAAATAAAATGG - Intergenic
1030811338 7:113975849-113975871 TCAATAGCCATTTACTAAAATGG + Intronic
1031132693 7:117850940-117850962 TGAACAGCTAAGCACTAAAAAGG + Intronic
1031314900 7:120244258-120244280 GGCAAAGCCATAAAATAAAATGG - Intergenic
1031332942 7:120488229-120488251 ATAAAAGGCATGAAGTAAAAAGG + Intronic
1035988961 8:4466536-4466558 TGGAAAACCATGAGCAAAAATGG + Intronic
1036081347 8:5559840-5559862 TAAAAAGCAAACAACTAAAAAGG + Intergenic
1037139929 8:15507369-15507391 TGATAAGGCATGAACTATAAAGG - Intronic
1038649703 8:29391234-29391256 TGAAAAGTCTTTAACTAATAAGG - Intergenic
1042192700 8:66203818-66203840 AGAAAAAACATGAAATAAAAAGG + Intergenic
1042830616 8:73023978-73024000 TTAAAAGCCATGAAGTTTAAAGG + Intronic
1043472089 8:80573191-80573213 TGTTAAGCCATCAAATAAAAAGG + Intergenic
1043607267 8:82017279-82017301 TGACAAGCTATGAACTAAGAAGG - Intergenic
1043630890 8:82331721-82331743 TAAAAAGCCATGAACTATTTTGG + Intergenic
1044499467 8:92935527-92935549 TGAAAAATAATGAACCAAAAAGG + Intronic
1044828155 8:96218631-96218653 TGAAACTCCATAGACTAAAAGGG - Intergenic
1045149778 8:99391512-99391534 TGAAAAACTAAAAACTAAAAAGG + Intronic
1045427742 8:102084100-102084122 AGAAAAGGCATGAACAAGAAAGG - Intronic
1046741572 8:117834659-117834681 TGAATATCCAAAAACTAAAAGGG + Intronic
1047838826 8:128724998-128725020 TTAGAAGCCATAAAATAAAATGG + Intergenic
1048387156 8:133922390-133922412 AGATAAACCATGAACTAAAGGGG + Intergenic
1048501510 8:134979954-134979976 TGAAAAACTATAAACTAAATAGG - Intergenic
1050518207 9:6468241-6468263 TGATAAGCCTTTAACAAAAATGG + Intronic
1051151210 9:14081147-14081169 TGAAAAGGAATGAGCTTAAATGG - Intergenic
1051209024 9:14722196-14722218 TCAAAAGCCATGAAGTACATTGG - Exonic
1051221998 9:14858619-14858641 TGAGAAGCCAAGAAATATAAGGG - Intronic
1052344668 9:27397346-27397368 TGAAAAGCCTTATATTAAAAGGG - Intronic
1054456971 9:65436947-65436969 TGAAATGCCCTGAAACAAAATGG + Intergenic
1054697118 9:68371588-68371610 TGAAAAGCCAAGAAAGAAGAGGG - Intronic
1055129838 9:72762417-72762439 TGAACAGCTATGATCTAAAGTGG - Intronic
1056526438 9:87447074-87447096 TGAAAAGCCATGGATTAGAGTGG + Intergenic
1056877041 9:90343383-90343405 TGAAAGTCAATGAATTAAAATGG - Intergenic
1057107742 9:92436340-92436362 TGAAAAGGCATGCAATAGAATGG - Intronic
1059056207 9:110983277-110983299 TGAACAGACATAAACTAAATTGG + Intronic
1059613422 9:115923499-115923521 TGAAAAGCCATGAAGTTTACAGG + Intergenic
1060612904 9:124984630-124984652 ATAGTAGCCATGAACTAAAATGG + Intronic
1060676397 9:125519184-125519206 TGAGGAGCCAGGAACTAAATTGG + Intronic
1186234526 X:7493310-7493332 TGAGAACTCATGAACTCAAAAGG - Intergenic
1186246768 X:7623152-7623174 TGAAAAGCCAACAACCCAAATGG + Intergenic
1187407402 X:19016137-19016159 TAAAATGCCATGCATTAAAATGG - Intronic
1188404054 X:29784651-29784673 AGAAAATCCATAAACTGAAAAGG - Intronic
1188646420 X:32573613-32573635 CTGAAAGCCATGCACTAAAAAGG + Exonic
1188830062 X:34885542-34885564 AGAAAAGCAATGAAGTTAAATGG + Intergenic
1190751820 X:53368771-53368793 TGAAAAGACATGCAATAGAAGGG + Intergenic
1194362511 X:92970512-92970534 TGACAACCCATGAACACAAAAGG + Intergenic
1194480547 X:94416441-94416463 TTAAAAACCATGAATTAAAAAGG - Intergenic
1194743634 X:97605035-97605057 TGAAAAGGCATGAACTATCGGGG + Intergenic
1195239099 X:102933426-102933448 TGGAAAGCCATCTTCTAAAAGGG - Intergenic
1195860965 X:109382446-109382468 TGAAAGGCCATGCAATAGAAAGG + Intronic
1196746429 X:119074462-119074484 TGAAAAGCCATGAACAAAAAAGG - Intergenic
1196951599 X:120930895-120930917 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196952283 X:120935756-120935778 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196952968 X:120940617-120940639 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196953653 X:120945477-120945499 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196954338 X:120950338-120950360 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196955021 X:120955198-120955220 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196955709 X:120960081-120960103 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196956390 X:120964942-120964964 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196957072 X:120969802-120969824 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196957754 X:120974662-120974684 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196958436 X:120979522-120979544 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196959117 X:120984382-120984404 TGAAAAGCCATGAACTAAAAGGG + Intronic
1197167580 X:123394745-123394767 TAAAGACACATGAACTAAAATGG + Intronic
1197322963 X:125055657-125055679 TGACAAGCCATGTTCTGAAAAGG + Intergenic
1197481887 X:126996191-126996213 TGGAAAGCCATTAAAAAAAAAGG + Intergenic
1198013265 X:132581868-132581890 GGAATAGCAAAGAACTAAAATGG - Intergenic
1198635682 X:138697533-138697555 TGGAAATCCATGAATGAAAAAGG + Intronic
1199125631 X:144116389-144116411 TGGAAAGACATGATCTCAAAGGG - Intergenic
1200670761 Y:6086732-6086754 TGACAACCCATGAACACAAAAGG + Intergenic
1201113776 Y:10820189-10820211 TGGAAAGCCATGAAATGGAATGG - Intergenic
1201140557 Y:11024731-11024753 TGAAATGCAATGGACTGAAATGG - Intergenic
1202173732 Y:22078555-22078577 TTAAAAACCATGAACGAACAAGG + Intronic
1202217629 Y:22507827-22507849 TTAAAAACCATGAACGAACAAGG - Intronic
1202325556 Y:23688232-23688254 TTAAAAACCATGAACGAACAAGG + Intergenic
1202545215 Y:25981822-25981844 TTAAAAACCATGAACGAACAAGG - Intergenic
1202611621 Y:56684066-56684088 TGGAAAGCAATGGACTGAAATGG + Intergenic