ID: 1196963054

View in Genome Browser
Species Human (GRCh38)
Location X:121025006-121025028
Sequence GGTAGATTCTGCATTCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196963051_1196963054 -1 Left 1196963051 X:121024984-121025006 CCCAAGAAGTAGGGTTTGAGAAG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG 0: 1
1: 0
2: 2
3: 9
4: 109
1196963048_1196963054 12 Left 1196963048 X:121024971-121024993 CCGGATGATGTGTCCCAAGAAGT 0: 1
1: 0
2: 1
3: 10
4: 98
Right 1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG 0: 1
1: 0
2: 2
3: 9
4: 109
1196963047_1196963054 13 Left 1196963047 X:121024970-121024992 CCCGGATGATGTGTCCCAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG 0: 1
1: 0
2: 2
3: 9
4: 109
1196963052_1196963054 -2 Left 1196963052 X:121024985-121025007 CCAAGAAGTAGGGTTTGAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 215
Right 1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG 0: 1
1: 0
2: 2
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196963054 Original CRISPR GGTAGATTCTGCATTCATAG AGG Intergenic
900539938 1:3197590-3197612 TGTAGATTCTTCAGTCTTAGTGG - Intronic
901203556 1:7480884-7480906 TGCAGATTCTGCATTAAGAGAGG - Intronic
906819774 1:48917453-48917475 GGTAAATGATGTATTCATAGAGG - Intronic
907392721 1:54168710-54168732 GGTAGGTGCTGCTTTCACAGGGG - Intronic
907657452 1:56358586-56358608 GCTGGATTCTGCAGTCACAGAGG + Intergenic
908593491 1:65658808-65658830 GGGAGAATCTGCATTCAAACAGG - Intergenic
908867433 1:68566114-68566136 GGTAGATTCCGCATCCACAGTGG + Intergenic
909766470 1:79362078-79362100 GGTAGATTGTGAATTCATTAAGG - Intergenic
911485368 1:98498343-98498365 AGTAGATTTTGCGTTCATAAAGG + Intergenic
916280013 1:163040122-163040144 TGTAGATTCTCCATTCCCAGAGG - Intergenic
916451013 1:164920389-164920411 GGCAGATACTGAATTCAGAGAGG - Intergenic
917036622 1:170754374-170754396 GATAGTCTCTGAATTCATAGTGG - Intergenic
917155921 1:171998944-171998966 GGTTGGTTCTGCAATCAGAGAGG + Intronic
921831432 1:219732219-219732241 GGTAAATTCTGTTTTCATATTGG - Intronic
923616413 1:235541972-235541994 GGTCAAATCTGCATTCACAGGGG + Intergenic
1065365799 10:24935829-24935851 GGTAGACTCTCCACTCCTAGGGG - Intronic
1067595860 10:47556535-47556557 GGAAGATTATGCATTAAAAGGGG - Intergenic
1068092573 10:52450705-52450727 GGGAGATTCTCCTTTCATATTGG - Intergenic
1070934752 10:80284515-80284537 GGTAGAATCTACCTTCAGAGGGG + Intronic
1072474552 10:95747549-95747571 GGTAGTTTCTGCATCATTAGGGG - Intronic
1076291667 10:129350111-129350133 GGTGGAGGCTGCATTCTTAGTGG - Intergenic
1078195570 11:9134154-9134176 TGTGGCTTCTGCATTCACAGGGG - Intronic
1078216119 11:9313536-9313558 GTGAGATTCTGCAATTATAGAGG + Intronic
1083800588 11:65044304-65044326 GGTAGATGCTGCCTTCCGAGAGG + Exonic
1084859604 11:72009660-72009682 GGGAGATTGTGCATGCAAAGAGG - Intronic
1087610481 11:100428222-100428244 GGGAGATTATGCATGCATGGGGG + Intergenic
1095164344 12:38954379-38954401 GGTAGATGCTTCACGCATAGTGG - Intergenic
1096239774 12:49953612-49953634 GGTAGATTCCGGACTCATAGCGG + Intronic
1098246577 12:68525215-68525237 GGTAGTTTCTGCATTTATTCAGG + Intergenic
1098824852 12:75283271-75283293 GCAACATTCTGCATTCGTAGTGG + Intronic
1105305502 13:19166001-19166023 GGTGGGGTCTGCATTCACAGAGG + Intergenic
1107279059 13:38712310-38712332 GGTAGTTGCTTAATTCATAGTGG + Intronic
1110333397 13:74298628-74298650 GGTAGATTTTGAAGTTATAGAGG + Intergenic
1112707731 13:102090786-102090808 GTTAGATTCTGACTTCATTGAGG - Intronic
1113286504 13:108854967-108854989 TTTAGATTCTGCATTCATGTAGG - Intronic
1118617825 14:67587066-67587088 GGTAGCTTCTGCAATCTAAGAGG - Exonic
1120344297 14:83265187-83265209 GCTAGAGTCTGCATTCAAAATGG + Intergenic
1120439211 14:84513827-84513849 GGTGGATTATGCATTCATGGTGG + Intergenic
1123987476 15:25658273-25658295 GGAAGATTCTGCATTGACTGTGG + Intergenic
1137812842 16:51369394-51369416 GCTAGATTCTTCCCTCATAGTGG + Intergenic
1139809436 16:69600799-69600821 GGAAGATCTTGAATTCATAGTGG + Intronic
1144819061 17:18058679-18058701 GGTTGAGTCTGCATTCAATGGGG + Intronic
1155329483 18:24700024-24700046 GGTCCATTCTGCGGTCATAGAGG + Intergenic
1155711844 18:28890728-28890750 GGTATATTCTGGCTTCATTGTGG - Intergenic
1156009553 18:32480810-32480832 AGTAGATTCTGCACACAGAGTGG + Intergenic
1166990749 19:46691206-46691228 GGTAGATTCTGCATTCTGATTGG - Intronic
1166990757 19:46691266-46691288 GGTAGATTCTGCATTCTGATTGG - Intronic
1166990768 19:46691382-46691404 AGTAGATTCTGCATTCATATTGG - Intronic
1167675808 19:50884544-50884566 GGTGGATTTTGCACTCAAAGTGG + Intergenic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
925339369 2:3125707-3125729 GGCAAATTCTTCACTCATAGAGG - Intergenic
926643591 2:15264305-15264327 TGTGGATTCTAAATTCATAGGGG - Intronic
929057458 2:37890867-37890889 GGAAGATTCTGCATACTTGGGGG + Intergenic
932163762 2:69486974-69486996 GCTGGTTTCTTCATTCATAGAGG - Intronic
936669771 2:114643705-114643727 GGTAGATCCTCCATTCTTTGTGG + Intronic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
939253764 2:139717097-139717119 GGTACATTGTGGATTCTTAGAGG - Intergenic
940321950 2:152386843-152386865 AGTAGATTCTGCTTTCAAAATGG + Intronic
943934790 2:193902450-193902472 GGAAGATTCTTAATTCATTGGGG - Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945289373 2:208112451-208112473 GGTCGCTGCTGCATTCGTAGTGG + Intergenic
945290667 2:208124297-208124319 GGTCGCTGCTGCATTCATAGTGG + Exonic
946784699 2:223230649-223230671 GGTAGATGCTGCTTCTATAGTGG + Intergenic
947065415 2:226218913-226218935 GGTAGATTATGCATTTCTAATGG + Intergenic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1172861141 20:38053147-38053169 GGTAGAAGCTGAATTGATAGTGG + Intronic
1175581609 20:60104241-60104263 GGTGGATTCTGCAACCATATGGG - Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1177965437 21:27720818-27720840 GGCAAAGTCTTCATTCATAGAGG - Intergenic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
1185007890 22:48295076-48295098 GGCAGATGCAGCATTCAGAGGGG + Intergenic
950952409 3:17014359-17014381 AATAGCTTCTGCATTCAAAGAGG - Intronic
952766626 3:36959934-36959956 GGAAGATTCGGCCTTCATGGTGG + Intergenic
963125441 3:141811624-141811646 GGAAGATTCTGCAATTATAGAGG - Intronic
965952222 3:174324008-174324030 TGTAGATTCTGCAATCATGATGG - Intergenic
967017574 3:185495883-185495905 GGTAGATTCTGCAATGACTGGGG + Intronic
967743605 3:193030181-193030203 GGTAGATTCTAAATTCAGTGTGG + Intergenic
969261943 4:6039169-6039191 TGCAGATTCAGCATTCTTAGGGG + Intronic
972929670 4:44056254-44056276 CTTAGCTCCTGCATTCATAGTGG - Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
978862597 4:113468796-113468818 GGTACATTCTGCATTCATCGTGG - Intronic
986298685 5:6461358-6461380 GGTAGACTCTGCATTCTCATGGG + Intronic
986872440 5:12065154-12065176 GGTAGACTCTGAATTCAATGTGG + Intergenic
991908068 5:71531894-71531916 GTTAGATTGTGAATTCATTGAGG + Intronic
1006575666 6:35043515-35043537 GAGAGTTTCTGCAGTCATAGCGG + Intronic
1008217145 6:48806595-48806617 GGGAGGTTCTGCATGCACAGAGG - Intergenic
1011101802 6:83730065-83730087 GTTAGATGATGCAATCATAGTGG + Intergenic
1011413711 6:87094178-87094200 GGGAGCTTCTGCATTCCTAAGGG + Intronic
1017487494 6:154916774-154916796 TGTAGTCTCTGCTTTCATAGGGG + Intronic
1025086363 7:56026797-56026819 GGTTCATTCTCCATTCTTAGTGG - Intronic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1029029532 7:97453327-97453349 GGGAGCTTCTGCATTTAAAGAGG + Intergenic
1030057457 7:105596013-105596035 GGTTGAATCAGCATTTATAGAGG - Intronic
1034651636 7:152695681-152695703 GGAAGATTCTGCTCTCAAAGAGG - Intergenic
1034950753 7:155295839-155295861 GGAAGATCCTGGAGTCATAGAGG - Intergenic
1045514815 8:102849355-102849377 GTTTGAGTCTGCATTCTTAGTGG - Intronic
1046564610 8:115883148-115883170 GGTAGATTCTAGATTGATACTGG + Intergenic
1046671605 8:117062645-117062667 GGAGGAGTCTGCATTCAGAGTGG + Intronic
1047028618 8:120851749-120851771 GGTCGATACTTAATTCATAGTGG - Intergenic
1049935936 9:502387-502409 GGCAGATTCTGAATTTTTAGTGG - Intronic
1050387589 9:5107328-5107350 GGTCAAATCTGCCTTCATAGGGG - Intronic
1051396216 9:16624543-16624565 GGTAGGTTTTGCTTTCTTAGCGG - Intronic
1052558383 9:30050281-30050303 GGTAAATTGTGCATGCATAGAGG + Intergenic
1052599009 9:30600141-30600163 GCTATATCCTGCAGTCATAGGGG - Intergenic
1053380873 9:37649346-37649368 GGAAGATTCTGAAGCCATAGTGG - Intronic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1058866176 9:109164224-109164246 GGTAGAATCTGTATGCAAAGAGG + Intronic
1058878520 9:109265916-109265938 GCTAGAAGCAGCATTCATAGAGG + Intronic
1203774872 EBV:67280-67302 GGTAGAGACTGCCTTCATCGAGG + Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1189050761 X:37642856-37642878 GGCCAATTCTGAATTCATAGTGG - Intronic
1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG + Intergenic
1199499113 X:148489781-148489803 GGTTAATTCTGCATTCAGATTGG - Intergenic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic