ID: 1196964138

View in Genome Browser
Species Human (GRCh38)
Location X:121037304-121037326
Sequence GAATTATCAGGCCTGTGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196964138_1196964142 18 Left 1196964138 X:121037304-121037326 CCTTGACACAGGCCTGATAATTC No data
Right 1196964142 X:121037345-121037367 TGACCAATTTTTACTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196964138 Original CRISPR GAATTATCAGGCCTGTGTCA AGG (reversed) Intergenic
No off target data available for this crispr