ID: 1196965176

View in Genome Browser
Species Human (GRCh38)
Location X:121047610-121047632
Sequence CAGACTCCCCGCGACTAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 41}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196965176 Original CRISPR CAGACTCCCCGCGACTAGGA AGG (reversed) Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
906408944 1:45563894-45563916 CAGACTCCCCTCAGCTGGGATGG - Intronic
908704057 1:66930942-66930964 CAGACTCCCCCCAACCTGGAGGG - Intronic
1069841232 10:71340658-71340680 CAAACTCACTGTGACTAGGATGG - Intronic
1071618128 10:87094822-87094844 CAGACTCCCCGCGACTAGGGAGG + Exonic
1072353882 10:94586811-94586833 CAGAATCCCAGCTACTCGGAAGG - Intronic
1076003601 10:126931007-126931029 CAGATTCCCTGCGTCGAGGATGG + Intronic
1076468873 10:130704644-130704666 CAGAGTCCCCGCCAGCAGGAAGG + Intergenic
1077031572 11:470417-470439 CAGGCTCCCCGAGGCTGGGACGG - Intronic
1105793969 13:23832281-23832303 CAGAGTCCCCACCAGTAGGAAGG + Intronic
1106810088 13:33350477-33350499 CAGACTCCCGGCGACTGGAAAGG + Intronic
1116470584 14:45281452-45281474 CTGACTTCCCGCAACAAGGAAGG - Intergenic
1123765811 15:23477580-23477602 CAGGCTCCCCCCGACTATGAAGG - Intergenic
1133931734 16:10238410-10238432 CATAATCCCAGCTACTAGGAAGG - Intergenic
1137587264 16:49671117-49671139 CAGGATTCCCGGGACTAGGAAGG + Intronic
1141703154 16:85651535-85651557 CAGCCGCCCCGCCACAAGGAGGG - Intronic
1148733622 17:49852125-49852147 CACCCTCCCCGCCACTAGAAGGG - Intergenic
1154402737 18:14057162-14057184 CAGAATGCCAGCTACTAGGAGGG + Intergenic
1159374868 18:67580199-67580221 CAGAATCCCCGCCAGCAGGAAGG + Intergenic
1160510184 18:79449041-79449063 CAGACCCCCCGGGACTGGGAGGG - Intronic
928091355 2:28377039-28377061 CACACTCCCAACCACTAGGACGG - Intergenic
931240670 2:60449626-60449648 CAGAGTCCCAGCCACTTGGATGG - Intergenic
944098646 2:195997394-195997416 CAGCCTCCCCGCGAGTAGCTGGG - Intronic
946621645 2:221569887-221569909 CAGACTCCCCGGGAAAAGTAGGG - Intronic
948908705 2:240992295-240992317 CAGAGTCCTTGCGACTGGGACGG - Intronic
1169477899 20:5949237-5949259 CAGAGTCCCAGCCACTAGGGAGG + Intronic
1175793579 20:61757527-61757549 CAGACTCCCCAGGACCAGGCAGG + Intronic
1179879368 21:44287048-44287070 CAGACTCCCCACCAAGAGGAAGG + Exonic
1181473323 22:23154005-23154027 CAGACTCCCAGGGCCTAGCAAGG - Intronic
1185130346 22:49035343-49035365 CAGGCCCCCTGTGACTAGGAAGG - Intergenic
951140019 3:19148140-19148162 CAGTCTCCCCGGGAGTGGGACGG + Intergenic
952331077 3:32364977-32364999 CAGAATCCCAGCTGCTAGGAAGG - Intronic
954749414 3:52805244-52805266 CAAACTCCCTGCCACTAGGCAGG + Intronic
976088825 4:81434166-81434188 CAGCCTCCCTGCTACTAGCAGGG + Intronic
976102954 4:81584851-81584873 CAGCCTCCCAGCTACTAGGGAGG - Intronic
983229949 4:165119419-165119441 CATATTCCCAGCGACTTGGAAGG - Intronic
983957577 4:173715862-173715884 CAGCCTCCCCCCAACCAGGAGGG - Intergenic
987078697 5:14407054-14407076 CACCCTTCCAGCGACTAGGAGGG + Intronic
996395553 5:123010213-123010235 CAGACTCCCTGCACCTGGGATGG - Intronic
1002598294 5:180338556-180338578 CAGAGTCCCCCGGACGAGGAAGG - Exonic
1014762235 6:125369246-125369268 CAGGGTCCCCGAGACTAGCAGGG + Intergenic
1035485147 7:159217589-159217611 CAGCCTCCCAGCCACTAGAAGGG + Intergenic
1046798500 8:118398275-118398297 CATAATCCCAGCTACTAGGAAGG + Intronic
1054450629 9:65401870-65401892 CAGACTCCTGGCGAGTGGGACGG + Intergenic
1186560770 X:10610392-10610414 CACACTCCACGTGACTAGTAGGG + Intronic
1196965176 X:121047610-121047632 CAGACTCCCCGCGACTAGGAAGG - Exonic