ID: 1196965411

View in Genome Browser
Species Human (GRCh38)
Location X:121049140-121049162
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196965411_1196965416 -5 Left 1196965411 X:121049140-121049162 CCCATTGTACCCACGGCAGAGTT 0: 2
1: 0
2: 0
3: 1
4: 65
Right 1196965416 X:121049158-121049180 GAGTTCCAAGACAGTATATCGGG 0: 1
1: 1
2: 0
3: 6
4: 119
1196965411_1196965418 30 Left 1196965411 X:121049140-121049162 CCCATTGTACCCACGGCAGAGTT 0: 2
1: 0
2: 0
3: 1
4: 65
Right 1196965418 X:121049193-121049215 AGACATTGTGCACTCTGCCTTGG 0: 1
1: 0
2: 1
3: 12
4: 158
1196965411_1196965415 -6 Left 1196965411 X:121049140-121049162 CCCATTGTACCCACGGCAGAGTT 0: 2
1: 0
2: 0
3: 1
4: 65
Right 1196965415 X:121049157-121049179 AGAGTTCCAAGACAGTATATCGG 0: 1
1: 1
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196965411 Original CRISPR AACTCTGCCGTGGGTACAAT GGG (reversed) Exonic
905033467 1:34902739-34902761 AGCTCTGCAGTGGCTAGAATGGG - Intronic
911753254 1:101523203-101523225 AACTATGCTGTGGGTACATATGG + Intergenic
912433186 1:109640500-109640522 AACTCTGCAGCGGGCACACTTGG + Intergenic
913449765 1:118985259-118985281 GACGCTGCCCTGGGCACAATAGG + Intronic
923317383 1:232794021-232794043 ACCTCAGCCGTGGTTGCAATAGG + Intergenic
924011657 1:239671724-239671746 TACTCTGCCTTGGATATAATTGG + Intronic
1064163853 10:12970310-12970332 AACTTTACCGTGGGTTCACTGGG + Intronic
1067858837 10:49822706-49822728 AACTCTGCAGTGGGGAAACTGGG + Intronic
1070509334 10:77146293-77146315 AACTGTGCCTTGGGTTCAAATGG + Intronic
1071613996 10:87057707-87057729 AACTCTGCCGTGGGTACAATGGG + Exonic
1076219744 10:128723621-128723643 AACTCTGCTGTGAGAACAACAGG - Intergenic
1080054600 11:27893042-27893064 AACCCTGGCGTAGGTGCAATAGG + Intergenic
1083202967 11:61131463-61131485 AACTCTGCACTGGGTTCAAATGG + Exonic
1089796334 11:120984223-120984245 AACTATGCCATTGGTAGAATTGG + Intronic
1089886485 11:121829683-121829705 AACTCTGCTGTGGGTGTGATGGG + Intergenic
1094207882 12:27859794-27859816 AACTCTGGAGAGGGTAGAATAGG - Intergenic
1101002413 12:100369971-100369993 CACTCTGTCATGGCTACAATTGG - Intronic
1102157675 12:110743633-110743655 AACTTTGCCCTGGCTAGAATCGG - Intergenic
1103126593 12:118428328-118428350 ATGTCTGCCATGGGTACAAGGGG - Intergenic
1111694046 13:91601212-91601234 AACTCTGTGTTTGGTACAATAGG + Intronic
1112205487 13:97319852-97319874 AAATCTTCCGTGGGAAAAATCGG + Intronic
1113503604 13:110797858-110797880 AAGTCTGCAGTGGGTAGACTGGG - Intergenic
1117580327 14:57145058-57145080 AACTCTGAACTGGGTATAATGGG - Intergenic
1134289720 16:12894102-12894124 AACTCTCCCCTGAGTCCAATAGG + Intergenic
1134382062 16:13736857-13736879 CACTCAGACGTGGATACAATTGG - Intergenic
1143835087 17:9685286-9685308 AACTCTGCCGTGGGTACTCCTGG - Intronic
1146526949 17:33575149-33575171 CACTCTGCTGTTGGTAGAATGGG - Intronic
1152381780 17:79945917-79945939 CAGTCTCCCGTGGGAACAATGGG - Intronic
1155095353 18:22550075-22550097 AATTTTGCCGTGGGGACACTTGG - Intergenic
1156194761 18:34761645-34761667 AACTATGACATGGGTACAAGAGG + Intronic
1164909443 19:31993553-31993575 AACTCTGCAGTATGGACAATGGG + Intergenic
927041086 2:19231023-19231045 AGCTCTGCCATTGGTACAACTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
933984615 2:87580460-87580482 AACTCTGTCGTGTGGGCAATGGG - Intergenic
936309236 2:111370340-111370362 AACTCTGTCGTGTGGGCAATGGG + Intergenic
942562045 2:177230015-177230037 AACTCTGCCTAGGGTATAGTGGG + Intronic
943104402 2:183526710-183526732 AACTATGTATTGGGTACAATGGG + Intergenic
943457964 2:188131124-188131146 CACTTTGCAGTGGTTACAATGGG - Intergenic
1170204389 20:13782971-13782993 AACTATGCCGTGGATAAAAGAGG - Exonic
1184238815 22:43200827-43200849 AACTTTGCCCTGGGCACACTGGG + Exonic
1185153164 22:49178090-49178112 AACTCAGCCATGGGCACCATGGG - Intergenic
949497746 3:4649008-4649030 AACTCTGTGGTGGGGACCATGGG - Intronic
950790920 3:15471334-15471356 AATTCTGCAATGGGTACATTGGG - Intronic
955564855 3:60233102-60233124 AACTCGGCAATGGGTACATTGGG + Intronic
956147403 3:66204785-66204807 ATGTCTGCCGTGTGTACAGTAGG + Intronic
956731639 3:72201884-72201906 AACTCAGCAGTGGGGACAGTTGG + Intergenic
960177554 3:114534615-114534637 AACTCAGCCCTGGGAACAAGTGG + Intronic
962003578 3:131326317-131326339 GACTTTGCCATGGGTGCAATGGG - Intronic
963383041 3:144556112-144556134 AACACTGTTATGGGTACAATGGG + Intergenic
968199353 3:196739445-196739467 AACTCCTCCGTGGATAAAATAGG + Intergenic
969710966 4:8843207-8843229 AACTATGGCCTGGGGACAATGGG + Intergenic
974787890 4:66644510-66644532 TAGTCTGCCAGGGGTACAATGGG + Intergenic
975049747 4:69846592-69846614 AACTCTGACTTGTGTACATTAGG - Intronic
1001149796 5:169217321-169217343 AACTCTGCCCTGCTTACAAGTGG - Intronic
1001562927 5:172681616-172681638 AATTCTGCCCTGGCCACAATGGG - Intronic
1005095308 6:22108478-22108500 AACACTGCTGTGGGAACAAGTGG + Intergenic
1006420594 6:33931473-33931495 CAGTCTGCCGTGGGGCCAATGGG - Intergenic
1034454573 7:151160362-151160384 AACTCTGTAGTGGGAACAGTGGG - Intronic
1043808041 8:84698764-84698786 AAGTCAGCAGTGTGTACAATAGG + Intronic
1045762797 8:105630102-105630124 TACTCTACAATGGGTACAATTGG - Intronic
1047987072 8:130246289-130246311 AATTCTGCCATTGGTACAAAAGG - Intronic
1049437672 8:142595204-142595226 GACTCTGCCGTGGATACACCTGG - Intergenic
1051360735 9:16279312-16279334 AACTCTGACTTGGGTTCATTGGG + Intergenic
1059359423 9:113729191-113729213 AATTCTACAGTGGATACAATAGG - Intergenic
1194084197 X:89505867-89505889 ATCTCAGCCGTGGCTACAAGGGG - Intergenic
1196611380 X:117718444-117718466 AATTCTGCCTGGGGTAGAATGGG - Intergenic
1196965411 X:121049140-121049162 AACTCTGCCGTGGGTACAATGGG - Exonic
1200436838 Y:3161753-3161775 ATCTCAGCCGTGGCTACAAGGGG - Intergenic