ID: 1196967936

View in Genome Browser
Species Human (GRCh38)
Location X:121078558-121078580
Sequence ATGCACTTTTAAAATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196967934_1196967936 2 Left 1196967934 X:121078533-121078555 CCATGGAGAAAGGACCTAACAAA No data
Right 1196967936 X:121078558-121078580 ATGCACTTTTAAAATAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196967936 Original CRISPR ATGCACTTTTAAAATAGTGA AGG Intergenic
No off target data available for this crispr